|
miRBase |
|
Mature sequence mmu-miR-136-5p |
|
| Accession | MIMAT0000148 |
| Previous IDs | mmu-miR-136 |
| Sequence |
5 - acuccauuuguuuugaugaugg - 26 |
| Deep sequencing | 351955 reads, 56 experiments |
| Evidence | experimental; cloned [1-2,4], PCR [3], Solexa [5-6] |
| Validated targets |
|
| Predicted targets |
|
Mature sequence mmu-miR-136-3p |
|
| Accession | MIMAT0004532 |
| Previous IDs | mmu-miR-136* |
| Sequence |
40 - aucaucgucucaaaugagucuu - 61 |
| Deep sequencing | 45694 reads, 55 experiments |
| Evidence | experimental; cloned [4], Solexa [5-6] |
| Predicted targets |
|
References |
|
| 1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
| 2 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
| 3 |
PMID:15854907
"RNAi-mediated allelic trans-interaction at the imprinted Rtl1/Peg11 locus"
Curr Biol. 15:743-749(2005).
|
| 4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|