![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-137 |
|||||
Accession | MI0000163 (change log) | ||||
Symbol | MGI:Mir137 | ||||
Description | Mus musculus miR-137 stem-loop | ||||
Gene family | MIPF0000106; mir-137 | ||||
Literature search |
![]()
63 open access papers mention mmu-mir-137 | ||||
Stem-loop |
ug g ug a - g 5' cuucgg acg guauucuuggg g uaaua cg a |||||| ||| ||||||||||| | ||||| || u 3' ggagcu ugc cauaagaauuc u auugu gc u ga g gu - u a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-137-5p |
|
Accession | MIMAT0016986 |
Previous IDs | mmu-miR-137* |
Sequence |
9 - acggguauucuuggguggauaau - 31 |
Deep sequencing | 225 reads, 17 experiments |
Evidence | experimental; Illumina [5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-137-3p |
|
Accession | MIMAT0000149 |
Previous IDs | mmu-miR-137 |
Sequence |
45 - uuauugcuuaagaauacgcguag - 67 |
Deep sequencing | 98612 reads, 41 experiments |
Evidence | experimental; cloned [1-3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|