![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR159a |
|||||
Accession | MI0000189 (change log) | ||||
Previous IDs | ath-MIR159 | ||||
Description | Arabidopsis thaliana miR159a stem-loop | ||||
Gene family | MIPF0000010; MIR159 | ||||
Literature search |
![]()
52 open access papers mention ath-MIR159a | ||||
Stem-loop |
aa cau -u ------ aga g a c g uc - cu guaa 5' guagagcuccuu aguucaaa gagu gagc aggguaa aaagcu cu ag uaug a ccaua agcc aauccuu a |||||||||||| |||||||| |||| |||| ||||||| |||||| || || |||| | ||||| |||| ||||||| g 3' caucucgaggga uuagguuu cuca uucg ucccguu uuucga ga uc auac u gguau uugg uuaggaa u ag cuu uu guaauu caa g c u g ua a -u aaaa |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
MIR159a was identified independently by Reinhart et al. [1] and Mette et al. [2]. The latter group referred to this sequence by the internal identifier MIR40a. This sequence is not related to C. elegans miR-40. MIR159a is thought to target mRNAs coding for MYB proteins which are known to bind to the promoter of the floral meristem identity gene LEAFY [3]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR159a |
|
Accession | MIMAT0000177 |
Sequence |
163 - uuuggauugaagggagcucua - 183 |
Evidence | experimental; cloned [1,4], Northern [1], 5'RACE [4], 454 [5-6], MPSS [5], Illumina [7] |
References |
|
1 |
PMID:12101121
"MicroRNAs in plants"
Genes Dev. 16:1616-1626(2002).
|
2 |
PMID:12226481
"Short RNAs can identify new candidate transposable element families in Arabidopsis"
Plant Physiol. 130:6-9(2002).
|
3 |
PMID:12202040
"Prediction of plant microRNA targets"
Cell. 110:513-520(2002).
|
4 |
PMID:16040653
"Expression of Arabidopsis MIRNA genes"
Plant Physiol. 138:2145-2154(2005).
|
5 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
6 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|
7 |
PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
J Exp Bot. 61:165-177(2010).
|