Stem-loop sequence ath-MIR159a

Accession

MI0000189 (change log)

Previous IDs

ath-MIR159

Description

Arabidopsis thaliana miR159a stem-loop

Gene family

MIPF0000010; MIR159

Literature search

52 open access papers mention ath-MIR159a
(490 sentences)

Stem-loop

               aa        cau    -u    ------       aga      g  a  c    g uc     -    cu       guaa 
5' guagagcuccuu  aguucaaa   gagu  gagc      aggguaa   aaagcu cu ag uaug a  ccaua agcc  aauccuu    a
   ||||||||||||  ||||||||   ||||  ||||      |||||||   |||||| || || |||| |  ||||| ||||  |||||||    g
3' caucucgaggga  uuagguuu   cuca  uucg      ucccguu   uuucga ga uc auac u  gguau uugg  uuaggaa    u
               ag        cuu    uu    guaauu       caa      g  c  u    g ua     a    -u       aaaa 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

MIR159a was identified independently by Reinhart et al. [1] and Mette et al. [2]. The latter group referred to this sequence by the internal identifier MIR40a. This sequence is not related to C. elegans miR-40. MIR159a is thought to target mRNAs coding for MYB proteins which are known to bind to the promoter of the floral meristem identity gene LEAFY [3].

Genome context

• Coordinates (TAIR10; GCA_000001735.1): chr1: 27713233-27713416 [-]
• Overlapping transcripts:

  intergenic

Database links

• RNAcentral:URS000079C3D6_3702
• miRBase Tracker:MI0000189

Mature sequence ath-miR159a

• Accession: MIMAT0000177
• Sequence: 163 - uuuggauugaagggagcucua - 183
• Evidence: experimental; cloned [1,4], Northern [1], 5'RACE [4], 454 [5-6], MPSS [5], Illumina [7]

References

1. PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2. PMID:12226481 "Short RNAs can identify new candidate transposable element families in Arabidopsis" Mette MF, van der Winden J, Matzke M, Matzke AJ Plant Physiol. 130:6-9(2002).
3. PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
4. PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
5. PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
6. PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
7. PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).