miRBase entry: ath-MIR161

Stem-loop ath-MIR161


Accession
MI0000193
Description
Arabidopsis thaliana ath-MIR161 precursor miRNA MIR161
Gene
family?
RF04079; MIR161

Literature search
12 open access papers mention ath-MIR161
(41 sentences)

Sequence


ugcuugaucucgguuuuugaccaguuuauugcgucgaUCAAUGCAUUGAAAGUGACUACAUCGGGGUuccgauuuuuuuuguucuucauaugaugaagcggaaacaguaaucaacccugguuuagucacuuucacugcauuaaucaaugcauuuguaaaaagagggaaaagca
(((((..((((((((...))))..((((((((((.(((.((((((.((((((((((((.(((((((((...(((.((((((..((((((...)))))))))))).)))....))))))))).)))))))))))).)))))).))).)))))...)))))..))))...)))))

Structure
     -ga    gguuuuugaccag     ---     c   C      U            C         -ccg   u      uu      a 
ugcuu   ucuc             uuuau   ugcgu gaU AAUGCA UGAAAGUGACUA AUCGGGGUu    auu uuuuug  cuucau  
|||||   ||||             |||||   ||||| ||| |||||| |||||||||||| |||||||||    ||| ||||||  |||||| u
acgaa   ggag             aaaug   acgua cua uuacgu acuuucacugau uggucccaa    uga aaaggc  gaagua  
     aag    -----------aa     uuu     a   a      c            u         cuaa   c      --      g 


Annotation confidence Low
Do you think this miRNA is real?
Comments
MIR161 is to target mRNAs coding for PPR repeat proteins [2].

Genome context
chr1: 17825685-17825857 [+]

Database links

Mature ath-miR161.2

Accession MIMAT0006779
Description Arabidopsis thaliana ath-miR161.2 mature miRNA
Sequence 38 - UCAAUGCAUUGAAAGUGACUA - 58
Evidence experimental
cloned [3], PARE [6], Illumina [7]

Mature ath-miR161.1

Accession MIMAT0000181
Description Arabidopsis thaliana ath-miR161.1 mature miRNA
Sequence 47 - UGAAAGUGACUACAUCGGGGU - 67
Evidence experimental
cloned [1,3], Northern [1], 5'RACE [3], 454 [4-5], MPSS [5], Illumina [7]

References

  1. PubMed ID: 12101121
    MicroRNAs in plants
    "Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP"
    "Genes Dev (2002) 16:1616-1626

  2. PubMed ID: 12202040
    Prediction of plant microRNA targets
    "Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP"
    "Cell (2002) 110:513-520

  3. PubMed ID: 16040653
    Expression of Arabidopsis MIRNA genes
    "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
    "Plant Physiol (2005) 138:2145-2154

  4. PubMed ID: 16954541
    MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
    "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
    "Genome Res (2006) 16:1276-1288

  5. PubMed ID: 17182867
    A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
    "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
    "Genes Dev (2006) 20:3407-3425

  6. PubMed ID: 19815687
    Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
    "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
    "J Exp Bot (2010) 61:165-177

  7. PubMed ID: 18542052
    Global identification of microRNA-target RNA pairs by parallel analysis of RNA ends
    "German MA, Pillay M, Jeong DH, Hetawal A, Luo S, Janardhanan P, Kannan V, Rymarquis LA, Nobuta K, German R, De Paoli E, Lu C, Schroth G, Meyers BC, Green PJ"
    "Nat Biotechnol (2008) 26:941-946