![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR162a |
||||||
Accession | MI0000194 (change log) | |||||
Description | Arabidopsis thaliana miR162a stem-loop | |||||
Gene family | MIPF0000127; MIR162_1 | |||||
Literature search |
![]()
17 open access papers mention ath-MIR162a | |||||
Stem-loop |
u ug - - - ug ----u g c c c c gaac u 5' agu g aagaa ga g agag cgcugga gcag gguu aucgaucu uuc ugu acau a ||| | ||||| || | |||| ||||||| |||| |||| |||||||| ||| ||| |||| a 3' uca u uucuu cu u ucuc gcgaccu cguc ccaa uagcuaga aag acg ugua a u gu a u a gu cguuu a u a u u aaaa a |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence ath-miR162a-5p |
|
Accession | MIMAT0031876 |
Sequence |
26 - uggaggcagcgguucaucgauc - 47 |
Evidence | not experimental |
References |
|
1 |
PMID:12101121
"MicroRNAs in plants"
Genes Dev. 16:1616-1626(2002).
|
2 |
PMID:12202040
"Prediction of plant microRNA targets"
Cell. 110:513-520(2002).
|
3 |
PMID:16040653
"Expression of Arabidopsis MIRNA genes"
Plant Physiol. 138:2145-2154(2005).
|
4 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
5 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|