Stem-loop sequence ath-MIR164b

Accession MI0000198
Description Arabidopsis thaliana miR164b stem-loop
Gene family MIPF0000045; MIR164
Stem-loop 
     a    ca         cauu          a    ----   u    c    --a      g     a     a 
gaugg gaag  gggcacgug    acuagcucau uaua    cac cuca caca   augcgu uauau ugcgg a
||||| ||||  |||||||||    |||||||||| ||||    ||| |||| ||||   |||||| ||||| |||||  
cuacc cuuc  cccguguac    ugauugagua guau    gug gagu gugu   ugugua auaua guguu u
     a    ua         uucu          g    agua   u    u    gug      g     -     u
Get sequence
Deep sequencing
441117 reads, 8 experiments
Comments

MIR164b is found on chromosome 5 in Arabidopsis thaliana [1] and is thought to target mRNAs coding for NAC domain containing proteins such as Cup-Shaped Cotyledon 2 (CUC2) which is required for shoot apical meristem formation [2].

Genome context
Coordinates (TAIR10) Overlapping transcripts
chr5: 287584-287736 [+]
intergenic
Database links

Mature sequence ath-miR164b

Accession MIMAT0000186
Sequence

3 -  

uggagaagcagggcacgugca

 - 23

Get sequence
Deep sequencing 440982 reads, 8 experiments
Evidence experimental; cloned [1,3], Northern [1], 5'RACE [3], 454 [4-5], MPSS [4], Solexa [6]
Validated targets

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
3
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).