miRBase entry: ath-MIR165b

Stem-loop ath-MIR165b


Accession
MI0000200
Description
Arabidopsis thaliana ath-MIR165b precursor miRNA
Gene family
MIPF0000004; MIR166

Literature search
44 open access papers mention ath-MIR165b
(246 sentences)

Sequence

ugaagaggcuauuucuguuguggggaauguuguuuggaucgaggauaucauaaacgcauacacauguuuauauguuaugaugcauuauaugacugauguaauguacauauauauacauacaugccacaugguaucgUCGGACCAGGCUUCAUCCCCCucaacauguuaauugccuucaauca
(((.(((((.(((.((((((.((((.(((..((((((.((((.((((((((....((((....((((..((((((.(((.((((((((((.....)))))))))))))))))))))))..))))...)))))))).)))).))))))..))).)))).))))).)..))).)))))...)))

Structure
   --a     u   -u -     u    a   uu      a    g        aaac    acac    uu      u   a          g 
uga   gaggc auu  c uguug gggg aug  guuugg ucga gauaucau    gcau    augu  auaugu aug ugcauuauau a
|||   ||||| |||  | ||||| |||| |||  |||||| |||| ||||||||    ||||    ||||  |||||| ||| |||||||||| c
acu   uuccg uaa  g acaac CCCC UAC  CGGACC GGCU cuauggua    cgua    uaca  uauaua uac auguaaugua u
   aac     u   uu u     u    C   UU      A    g        -cac    --ca    --      -   -          g 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
MIR165b is thought to target mRNAs coding for HD-Zip transcription factors including Phabulosa (PHB) and Phavoluta (PHV) that regulate axillary meristem initiation and leaf development [2].

Genome context
chr4: 369831-370012 [-]

Database links

Mature ath-miR165b

Accession MIMAT0000188
Description Arabidopsis thaliana ath-miR165b mature miRNA
Sequence 137 - UCGGACCAGGCUUCAUCCCCC - 157
Evidence experimental
cloned [1,3], Northern [1], 454 [4-5], MPSS [4], Illumina [6]

References

  1. PubMed ID: 12101121
    MicroRNAs in plants
    "Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP"
    "Genes Dev (2002) 16:1616-1626

  2. PubMed ID: 12202040
    Prediction of plant microRNA targets
    "Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP"
    "Cell (2002) 110:513-520

  3. PubMed ID: 16040653
    Expression of Arabidopsis MIRNA genes
    "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
    "Plant Physiol (2005) 138:2145-2154

  4. PubMed ID: 16954541
    MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
    "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
    "Genome Res (2006) 16:1276-1288

  5. PubMed ID: 17182867
    A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
    "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
    "Genes Dev (2006) 20:3407-3425

  6. PubMed ID: 19815687
    Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
    "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
    "J Exp Bot (2010) 61:165-177