miRBase entry: ath-MIR167b

Stem-loop ath-MIR167b


Accession
MI0000209
Description
Arabidopsis thaliana ath-MIR167b precursor miRNA
Gene family
MIPF0000023; MIR167_1

Literature search
43 open access papers mention ath-MIR167b
(201 sentences)

Sequence

gggaacaagUGAAGCUGCCAGCAUGAUCUAucuuugguuaagagaugaauguggaaacauauugcuuaaacccaagcuaggucaugcucugacagccucacuccuuccu
(((((..(((((.(((((.(((((((((((.(((.((((..(((...((((((....)))))).))).)))).))).)))))))))))..).)))).)))))..)))))

Structure
     ca     A    - -C           u   u    aa   aug      g 
gggaa  agUGA GCUG C  AGCAUGAUCUA cuu gguu  gag   aaugug a
|||||  ||||| |||| |  ||||||||||| ||| ||||  |||   ||||||  
uccuu  ucacu cgac g  ucguacuggau gaa ccaa  uuc   uuauac a
     cc     c    a uc           c   c    -a   --g      a 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
MIR167b is thought, like miR160, to target mRNAs coding for auxin response factors, DNA binding proteins that are thought to control transcription in response to the phytohormone auxin. Transcriptional regulation is important for many of the diverse developmental responses to auxin signals, which include cell elongation, division, and differentiation in both roots and shoots [2].

Genome context
chr3: 23406168-23406276 [+]

Database links

Mature ath-miR167b

Accession MIMAT0000197
Description Arabidopsis thaliana ath-miR167b mature miRNA
Sequence 10 - UGAAGCUGCCAGCAUGAUCUA - 30
Evidence experimental
cloned [1,3], Northern [1], 5'RACE [3], 454 [4-5], MPSS [4], Illumina [6]

References

  1. PubMed ID: 12101121
    MicroRNAs in plants
    "Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP"
    "Genes Dev (2002) 16:1616-1626

  2. PubMed ID: 12202040
    Prediction of plant microRNA targets
    "Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP"
    "Cell (2002) 110:513-520

  3. PubMed ID: 16040653
    Expression of Arabidopsis MIRNA genes
    "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
    "Plant Physiol (2005) 138:2145-2154

  4. PubMed ID: 16954541
    MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
    "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
    "Genome Res (2006) 16:1276-1288

  5. PubMed ID: 17182867
    A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
    "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
    "Genes Dev (2006) 20:3407-3425

  6. PubMed ID: 19815687
    Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
    "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
    "J Exp Bot (2010) 61:165-177