![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR168b |
|||||
Accession | MI0000211 (change log) | ||||
Description | Arabidopsis thaliana miR168b stem-loop | ||||
Gene family | MIPF0000081; MIR168 | ||||
Literature search |
![]()
28 open access papers mention ath-MIR168b | ||||
Stem-loop |
gg u g c u acugauug g -- a uc 5' uuacc cgg cuc gauucg uuggugcagg cggga gcu ac accgac cgug u ||||| ||| ||| |||||| |||||||||| ||||| ||| || |||||| |||| 3' agugg gcc gag cuaagu aacuauguuc gcccu cga ug ugguug guac u -a u g c u -------- g uu - ug |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
MIR168b thought to target mRNAs coding for Argonaute (AGO1), which is required for axillary shoot meristem formation and leaf development in Arabidopsis. It has been suggested that AGO1 may also influence miRNA accumulation in plants and that miR168 may act as a negative-feedback mechanism for controlling expression of the AGO1 gene [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR168b-3p |
|
Accession | MIMAT0031885 |
Sequence |
89 - cccgucuuguaucaacugaau - 109 |
Evidence | not experimental |
References |
|
1 |
PMID:12101121
"MicroRNAs in plants"
Genes Dev. 16:1616-1626(2002).
|
2 |
PMID:12202040
"Prediction of plant microRNA targets"
Cell. 110:513-520(2002).
|
3 |
PMID:16040653
"Expression of Arabidopsis MIRNA genes"
Plant Physiol. 138:2145-2154(2005).
|
4 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
5 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|
6 |
PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
J Exp Bot. 61:165-177(2010).
|