Stem-loop sequence ath-MIR168b

AccessionMI0000211 (change log)
DescriptionArabidopsis thaliana miR168b stem-loop
Gene family MIPF0000081; MIR168
Literature search

28 open access papers mention ath-MIR168b
(77 sentences)

Stem-loop 
        gg   u   g      c          u     acugauug   g  --      a    uc 
5' uuacc  cgg cuc gauucg uuggugcagg cggga        gcu ac  accgac cgug  u
   |||||  ||| ||| |||||| |||||||||| |||||        ||| ||  |||||| ||||   
3' agugg  gcc gag cuaagu aacuauguuc gcccu        cga ug  ugguug guac  u
        -a   u   g      c          u     --------   g  uu      -    ug
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

MIR168b thought to target mRNAs coding for Argonaute (AGO1), which is required for axillary shoot meristem formation and leaf development in Arabidopsis. It has been suggested that AGO1 may also influence miRNA accumulation in plants and that miR168 may act as a negative-feedback mechanism for controlling expression of the AGO1 gene [2].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 18358788-18358911 [-]
intergenic
Database links

Mature sequence ath-miR168b-5p

Accession MIMAT0000199
Previous IDsath-miR168b
Sequence

19 -  

ucgcuuggugcaggucgggaa

 - 39

Get sequence
Evidence experimental; cloned [1,3], Northern [1], 454 [4-5], MPSS [4], Illumina [6]

Mature sequence ath-miR168b-3p

Accession MIMAT0031885
Sequence

89 -  

cccgucuuguaucaacugaau

 - 109

Get sequence
Evidence not experimental

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
3
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).