Stem-loop sequence ath-MIR172b

AccessionMI0000216 (change log)
Previous IDsath-MIR172a2
DescriptionArabidopsis thaliana miR172b stem-loop
Gene family MIPF0000035; MIR172
Literature search

57 open access papers mention ath-MIR172b
(295 sentences)

Stem-loop 
   --a gc      c           a    gaa  uga    u        
5'    g  gcagca cauuaagauuc caug   au   uaaa acccuaa 
      |  |||||| ||||||||||| ||||   ||   |||| |||||| a
3'    c  cgucgu guaguucuaag guau   ua   guuu ugggauu 
   caa ua      a           a    aug  -ua    -
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was independently identified by two groups. Park et al. described miR172a2, found on chromosome 5 in Arabidopsis thaliana and thought to target mRNAs coding for Apetala 2 (AP2) proteins, and miR172a1 (MI0000215) [1]. These sequences have been renamed miR172b and miR172a here to match previous plant miRNA nomenclature. This sequence was referred to by Mette et al. by the internal identifier MIR123b [2], and was previously identified as MIR180b here. This sequence is not related to mouse miR-123. Wang et al. [2] report Northern blot evidence for the miR172b* sequence from the opposite arm of the precursor.

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 1188207-1188301 [-]
intergenic
Database links

Mature sequence ath-miR172b-5p

Accession MIMAT0000204
Previous IDsath-miR172b*
Sequence

5 -  

gcagcaccauuaagauucac

 - 24

Get sequence
Evidence experimental; Northern [3], 454 [6]

Mature sequence ath-miR172b-3p

Accession MIMAT0000205
Previous IDsath-miR172b
Sequence

71 -  

agaaucuugaugaugcugcau

 - 91

Get sequence
Evidence experimental; cloned [1], 5'RACE [4], 454 [5-6], MPSS [5], Illumina [7]

References

1
PMID:12225663 "CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana" Park W, Li J, Song R, Messing J, Chen X Curr Biol. 12:1484-1495(2002).
2
PMID:12226481 "Short RNAs can identify new candidate transposable element families in Arabidopsis" Mette MF, van der Winden J, Matzke M, Matzke AJ Plant Physiol. 130:6-9(2002).
3
PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets" Wang XJ, Reyes JL, Chua NH, Gaasterland T Genome Biol. 5:R65(2004).
4
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
5
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
6
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
7
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).