![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR172b |
|||||
Accession | MI0000216 (change log) | ||||
Previous IDs | ath-MIR172a2 | ||||
Description | Arabidopsis thaliana miR172b stem-loop | ||||
Gene family | MIPF0000035; MIR172 | ||||
Literature search |
![]()
57 open access papers mention ath-MIR172b | ||||
Stem-loop |
--a gc c a gaa uga u 5' g gcagca cauuaagauuc caug au uaaa acccuaa | |||||| ||||||||||| |||| || |||| |||||| a 3' c cgucgu guaguucuaag guau ua guuu ugggauu caa ua a a aug -ua - |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence was independently identified by two groups. Park et al. described miR172a2, found on chromosome 5 in Arabidopsis thaliana and thought to target mRNAs coding for Apetala 2 (AP2) proteins, and miR172a1 (MI0000215) [1]. These sequences have been renamed miR172b and miR172a here to match previous plant miRNA nomenclature. This sequence was referred to by Mette et al. by the internal identifier MIR123b [2], and was previously identified as MIR180b here. This sequence is not related to mouse miR-123. Wang et al. [2] report Northern blot evidence for the miR172b* sequence from the opposite arm of the precursor. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR172b-5p |
|
Accession | MIMAT0000204 |
Previous IDs | ath-miR172b* |
Sequence |
5 - gcagcaccauuaagauucac - 24 |
Evidence | experimental; Northern [3], 454 [6] |
Mature sequence ath-miR172b-3p |
|
Accession | MIMAT0000205 |
Previous IDs | ath-miR172b |
Sequence |
71 - agaaucuugaugaugcugcau - 91 |
Evidence | experimental; cloned [1], 5'RACE [4], 454 [5-6], MPSS [5], Illumina [7] |
References |
|
1 |
PMID:12225663
"CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana"
Curr Biol. 12:1484-1495(2002).
|
2 |
PMID:12226481
"Short RNAs can identify new candidate transposable element families in Arabidopsis"
Plant Physiol. 130:6-9(2002).
|
3 |
PMID:15345049
"Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets"
Genome Biol. 5:R65(2004).
|
4 |
PMID:16040653
"Expression of Arabidopsis MIRNA genes"
Plant Physiol. 138:2145-2154(2005).
|
5 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
6 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|
7 |
PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
J Exp Bot. 61:165-177(2010).
|