Stem-loop sequence mmu-mir-181a-2

AccessionMI0000223
Previous IDsmmu-mir-181;mmu-mir-181a
Symbol MGI:Mir181a-2
DescriptionMus musculus miR-181a-2 stem-loop
Gene family MIPF0000007; mir-181
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-181_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-181 microRNA precursor is a small non-coding RNA molecule. MicroRNAs (miRNAs) are transcribed as ~70 nucleotide precursors and subsequently processed by the RNase-III type enzyme Dicer to give a ~22 nucleotide mature product. In this case the mature sequence comes from the 5' arm of the precursor. They target and modulate protein expression by inhibiting translation and / or inducing degradation of target messenger RNAs. This new class of genes has recently been shown to play a central role in malignant transformation. miRNA are downregulated in many tumors and thus appear to function as tumor suppressor genes. The mature products miR-181a, miR-181b, miR-181c or miR-181d are thought to have regulatory roles at posttranscriptional level, through complementarity to target mRNAs. miR-181 which has been predicted or experimentally confirmed in a wide number of vertebrate species as rat, zebrafish, and in the pufferfish (see below) (MIPF0000007).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      u  a   u      cu       a    gggauuc 
5' cca gg aca ucaacg  gucggug guuu       a
   ||| || ||| ||||||  ||||||| ||||       a
3' ggu cc ugu aguugc  cagccac caaa       a
      u  a   c      --       -    aaaacaa 
Get sequence
Deep sequencing
2197991 reads, 6.54e+03 reads per million, 108 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

Mouse miR-181a (previously named miR-181 here and in [1]) was cloned from various mouse tissues in [1]. Expression has also been validated in zebrafish [2].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr2: 38852735-38852810 [+]
antisense
OTTMUST00000030867 ; Nr6a1-002; intron 2
OTTMUST00000029378 ; Nr6a1-001; intron 4
ENSMUST00000142130 ; Nr6a1-002; intron 2
ENSMUST00000076275 ; Nr6a1-201; intron 3
ENSMUST00000112877 ; Nr6a1-001; intron 4
Clustered miRNAs
< 10kb from mmu-mir-181a-2
mmu-mir-181a-2chr2: 38852735-38852810 [+]
mmu-mir-181b-2chr2: 38853830-38853918 [+]
Database links

Mature sequence mmu-miR-181a-5p

Accession MIMAT0000210
Previous IDsmmu-miR-181a
Sequence

7 - 

aacauucaacgcugucggugagu

 - 29

Get sequence
Deep sequencing3085494 reads, 92 experiments
Evidence experimental; cloned [2,4], Illumina [5-6]
Validated targets
Predicted targets

Mature sequence mmu-miR-181a-2-3p

Accession MIMAT0005443
Previous IDsmmu-miR-181a-2*
Sequence

54 - 

accgaccguugacuguaccuug

 - 75

Get sequence
Deep sequencing4640 reads, 69 experiments
Evidence experimental; cloned [5], Illumina [6-7]
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).