![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-190a |
|||||
Accession | MI0000232 (change log) | ||||
Previous IDs | mmu-mir-190 | ||||
Symbol | MGI:Mir190a | ||||
Description | Mus musculus miR-190 stem-loop | ||||
Gene family | MIPF0000076; mir-190 | ||||
Literature search |
![]()
19 open access papers mention mmu-mir-190a | ||||
Stem-loop |
- ug ua uuau 5' cugu g auauguuugauauau gguug u |||| | ||||||||||||||| ||||| 3' gaca c uauacgaacuauaua ucaac u u cu -- cuaa |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-190a-5p |
|
Accession | MIMAT0000220 |
Previous IDs | mmu-miR-190;mmu-miR-190-5p |
Sequence |
6 - ugauauguuugauauauuaggu - 27 |
Deep sequencing | 18266 reads, 77 experiments |
Evidence | experimental; cloned [1-2], Illumina [4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-190a-3p |
|
Accession | MIMAT0016998 |
Previous IDs | mmu-miR-190*;mmu-miR-190-3p |
Sequence |
42 - acuauauaucaagcauauuccu - 63 |
Deep sequencing | 179 reads, 35 experiments |
Evidence | experimental; 454 [3], Illumina [4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12554859
"New microRNAs from mouse and human"
RNA. 9:175-179(2003).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|