![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-192 |
||||||||
Accession | MI0000234 (change log) | |||||||
Symbol | HGNC:MIR192 | |||||||
Description | Homo sapiens miR-192 stem-loop | |||||||
Gene family | MIPF0000063; mir-192 | |||||||
Literature search |
![]()
214 open access papers mention hsa-mir-192 | |||||||
Stem-loop |
gccgagacc u -- g g c - a ugcucuc 5' gag gc aca g cu ugaccuaug aauug cagccag g ||| || ||| | || ||||||||| ||||| ||||||| 3' cuc cg ugu u ga acuggauac uuaac gucgguc u cgaccguaa - cu a g c c c uccccuc |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Comments |
Lagos-Quintana et al. validated the presence of an 18 nt excised sequence by cloning [1]. Lim et al. predicted the miR by computational methods using conservation with mouse and Fugu rubripes sequences. Expression of the excised miR was validated in zebrafish, and the 5' end mapped by PCR [2]. The 3' ends of the reported sequences differ by 3 nt - this entry contains the longer sequence. Lim et al. report three separate copies of this gene named mir-192-1, -2 and -3 based on 2001 human genome assemblies [2]. Subsequent assemblies suggest the presence of only one gene located on chromosome 11. |
|||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence hsa-miR-192-5p |
|
Accession | MIMAT0000222 |
Previous IDs | hsa-miR-192 |
Sequence |
24 - cugaccuaugaauugacagcc - 44 |
Deep sequencing | 1045071 reads, 159 experiments |
Evidence | experimental; cloned [3-4] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-192-3p |
|
Accession | MIMAT0004543 |
Previous IDs | hsa-miR-192* |
Sequence |
67 - cugccaauuccauaggucacag - 88 |
Deep sequencing | 452 reads, 93 experiments |
Evidence | experimental; cloned [4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12554859
"New microRNAs from mouse and human"
RNA. 9:175-179(2003).
|
2 |
PMID:12624257
"Vertebrate microRNA genes"
Science. 299:1540(2003).
|
3 |
PMID:14573789
"Reduced accumulation of specific microRNAs in colorectal neoplasia"
Mol Cancer Res. 1:882-891(2003).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|