Stem-loop sequence hsa-mir-192

Accession

MI0000234

Symbol

HGNC:MIR192

Description

Homo sapiens miR-192 stem-loop

Gene family

MIPF0000063; mir-192

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-192/215_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-192 microRNA precursor (homologous to miR-215), is a short non-coding RNA gene involved in gene regulation. miR-192 and miR-215 have now been predicted or experimentally confirmed in mouse and human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-192 and mir-215 are thought to be positive regulators of p53, a human tumour suppressor. They are also overexpressed in gastric cancer, and could potentially be used as biomarkers or therapeutic targets. It has also been suggested that mir-192 could be used as a biomarker for drug-induced liver damage.

Stem-loop

   gccgagacc   u  --   g g  c         -     a       ugcucuc 
5'          gag gc  aca g cu ugaccuaug aauug cagccag       g
            ||| ||  ||| | || ||||||||| ||||| |||||||        
3'          cuc cg  ugu u ga acuggauac uuaac gucgguc       u
   cgaccguaa   -  cu   a g  c         c     c       uccccuc 

Deep sequencing

327631 reads, 4.81e+03 reads per million, 72 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Lagos-Quintana et al. validated the presence of an 18 nt excised sequence by cloning [1]. Lim et al. predicted the miR by computational methods using conservation with mouse and Fugu rubripes sequences. Expression of the excised miR was validated in zebrafish, and the 5' end mapped by PCR [2]. The 3' ends of the reported sequences differ by 3 nt - this entry contains the longer sequence. Lim et al. report three separate copies of this gene named mir-192-1, -2 and -3 based on 2001 human genome assemblies [2]. Subsequent assemblies suggest the presence of only one gene located on chromosome 11.

Genome context

• Coordinates (GRCh38): chr11: 64891137-64891246 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000385272 ; SYVN1-012; intron 1

  ENST00000530451 ; SYVN1-012; intron 1

  antisense

  OTTHUMT00000385288 ; MRPL49-002; intron 1

  OTTHUMT00000385289 ; MRPL49-007; intron 1

  OTTHUMT00000385290 ; MRPL49-008; intron 1

  OTTHUMT00000385291 ; MRPL49-004; intron 1

  OTTHUMT00000385292 ; MRPL49-006; intron 1

  OTTHUMT00000385293 ; MRPL49-001; intron 1

  OTTHUMT00000385294 ; MRPL49-009; intron 1

  OTTHUMT00000385295 ; MRPL49-005; intron 1

  ENST00000524482 ; MRPL49-002; intron 1

  ENST00000528529 ; MRPL49-007; intron 1

  ENST00000534078 ; MRPL49-008; intron 1

  ENST00000526319 ; MRPL49-004; intron 1

  ENST00000526171 ; MRPL49-006; intron 1

  ENST00000279242 ; MRPL49-001; intron 1

  ENST00000531705 ; MRPL49-009; intron 1

  ENST00000533943 ; MRPL49-005; intron 1

Clustered miRNAs

< 10kb from hsa-mir-192

• hsa-mir-6750: chr11: 64898363-64898437 [-]
• hsa-mir-194-2: chr11: 64891355-64891439 [-]
• hsa-mir-192: chr11: 64891137-64891246 [-]

Database links

• MIRBASE-TRACKER:MI0000234
• ENTREZGENE: 406967;MIR192
• HGNC: 31562;MIR192
• RNACENTRAL:URS00006ECF62/9606

Mature sequence hsa-miR-192-5p

• Accession: MIMAT0000222
• Previous IDs: hsa-miR-192
• Sequence: 24 - cugaccuaugaauugacagcc - 44
• Deep sequencing: 16241 reads, 63 experiments
• Evidence: experimental; cloned [3-4]
• Validated targets:
  • MIRTARBASE:hsa-miR-192-5p
  • TARBASE:hsa-miR-192-5p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-192-5p
  • MICRORNA.ORG:hsa-miR-192-5p
  • MIRDB:hsa-miR-192-5p
  • RNA22-HSA:hsa-miR-192-5p
  • TARGETMINER:hsa-miR-192-5p
  • TARGETSCAN-VERT:hsa-miR-192
  • PICTAR-VERT:hsa-miR-192

Mature sequence hsa-miR-192-3p

• Accession: MIMAT0004543
• Previous IDs: hsa-miR-192*
• Sequence: 67 - cugccaauuccauaggucacag - 88
• Deep sequencing: 18 reads, 11 experiments
• Evidence: experimental; cloned [4]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-192-3p
  • MICRORNA.ORG:hsa-miR-192-3p
  • MIRDB:hsa-miR-192-3p
  • RNA22-HSA:hsa-miR-192-3p
  • TARGETMINER:hsa-miR-192-3p

References

1. PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
3. PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).