miRBase entry: mmu-mir-193a

Stem-loop mmu-mir-193a


Accession
MI0000235
Symbol
MGI: Mir193a
Description
Mus musculus mmu-mir-193a precursor miRNA mir-193
Gene
family?
RF01895; mir-193

Literature search
52 open access papers mention mmu-mir-193a
(572 sentences)

Sequence

42061 reads, 386 reads per million, 98 experiments
gagagcUGGGUCUUUGCGGGCAAGAUGAgagugucaguucAACUGGCCUACAAAGUCCCAGUccuc
(((.((((((.(((((.((((.((.((((........)))).)).)))).))))).)))))).)))

Structure
   a      U     C    A  A    agu 
gag gcUGGG CUUUG GGGC AG UGAg   g
||| |||||| ||||| |||| || ||||    
cuc UGACCC GAAAC UCCG UC Acuu   u
   c      U     A    G  A    gac 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr11: 79711969-79712034 [+]

Database links

Mature mmu-miR-193a-5p

Accession MIMAT0004544
Description Mus musculus mmu-miR-193a-5p mature miRNA
Sequence 7 - UGGGUCUUUGCGGGCAAGAUGA - 28
Evidence experimental
cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-193a-3p

Accession MIMAT0000223
Description Mus musculus mmu-miR-193a-3p mature miRNA
Sequence 41 - AACUGGCCUACAAAGUCCCAGU - 62
Evidence experimental
cloned [1-3], Northern [2], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179

  3. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009