Stem-loop sequence hsa-mir-198

AccessionMI0000240 (change log)
Symbol HGNC:MIR198
DescriptionHomo sapiens miR-198 stem-loop
Gene family MIPF0000090; mir-198
Literature search

43 open access papers mention hsa-mir-198
(230 sentences)

Stem-loop 
        -gg  cag        u   uuccug 
5' ucauu   uc   aggggaga agg      u
   |||||   ||   |||||||| |||       
3' aguaa   ag   ucucuucu ucc      g
        aua  aua        -   uuuuua
Get sequence
Deep sequencing
39 reads, 7.41 reads per million, 27 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 120395668-120395729 [-]
sense
OTTHUMT00000355410 ; HGD-001; intron 1
OTTHUMT00000355419 ; HGD-010; intron 1
OTTHUMT00000355417 ; HGD-008; intron 1
OTTHUMT00000355411 ; HGD-002; intron 1
OTTHUMT00000355416 ; HGD-007; intron 2
OTTHUMT00000355412 ; HGD-003; intron 2
ENST00000283871 ; HGD-001; intron 1
ENST00000476082 ; HGD-010; intron 1
ENST00000466528 ; HGD-008; intron 1
ENST00000480862 ; HGD-002; intron 1
ENST00000485313 ; HGD-007; intron 2
ENST00000488183 ; HGD-003; intron 2
Database links

Mature sequence hsa-miR-198

Accession MIMAT0000228
Sequence

6 -  

gguccagaggggagauagguuc

 - 27

Get sequence
Deep sequencing11 reads, 9 experiments
Evidence experimental; cloned [1-2]
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).