![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-198 |
|||||
Accession | MI0000240 (change log) | ||||
Symbol | HGNC:MIR198 | ||||
Description | Homo sapiens miR-198 stem-loop | ||||
Gene family | MIPF0000090; mir-198 | ||||
Literature search |
![]()
43 open access papers mention hsa-mir-198 | ||||
Stem-loop |
-gg cag u uuccug 5' ucauu uc aggggaga agg u ||||| || |||||||| ||| 3' aguaa ag ucucuucu ucc g aua aua - uuuuua |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-198 |
|
Accession | MIMAT0000228 |
Sequence |
6 - gguccagaggggagauagguuc - 27 |
Deep sequencing | 11 reads, 9 experiments |
Evidence | experimental; cloned [1-2] |
Predicted targets |
|
References |
|
1 |
PMID:12554859
"New microRNAs from mouse and human"
RNA. 9:175-179(2003).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|