miRBase entry: hsa-mir-198

Stem-loop hsa-mir-198


Accession
MI0000240
Symbol
HGNC: MIR198
Description
Homo sapiens hsa-mir-198 precursor miRNA

Literature search
43 open access papers mention hsa-mir-198
(230 sentences)

Sequence

8 reads, 3 reads per million, 7 experiments
ucauuGGUCCAGAGGGGAGAUAGGUUCcugugauuuuuccuucuucucuauagaauaaauga
(((((..((...((((((((.(((..............)))))))))))...))...)))))

Structure
     -GG  CAG        U   UUCcug 
ucauu   UC   AGGGGAGA AGG      u
|||||   ||   |||||||| |||       
aguaa   ag   ucucuucu ucc      g
     aua  aua        -   uuuuua 


Annotation confidence Low
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr3: 120395668-120395729 [-]

Disease association
hsa-mir-198 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-198

Accession MIMAT0000228
Description Homo sapiens hsa-miR-198 mature miRNA
Sequence 6 - GGUCCAGAGGGGAGAUAGGUUC - 27
Evidence experimental
cloned [1-2]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179