![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-199a-1 |
|||||
Accession | MI0000242 (change log) | ||||
Previous IDs | hsa-mir-199-s | ||||
Symbol | HGNC:MIR199A1 | ||||
Description | Homo sapiens miR-199a-1 stem-loop | ||||
Gene family | MIPF0000040; mir-199 | ||||
Literature search |
![]()
378 open access papers mention hsa-mir-199a-1 | ||||
Stem-loop |
aac u c u ---g 5' gcc ccagugu cagacuac ugu ca gagg ||| ||||||| |||||||| ||| || ||| c 3' cgg gguuaca gucugaug aca gu cucu auu c - u guaa |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
Lagos-Quintana et al. [1] cloned miR-199 from human osteoblast sarcoma cells. They also reported identification of a miRNA from the opposite arm in mouse cells. This sequence was named miR-199-s and the sequence from the 3' arm of the homologous mouse precursor miR-199-as. Lim et al. [2] independently predicted this miRNA computationally using conservation with mouse and Fugu rubripes sequences [2]. Expression of the miR excised from the 5' arm was validated in zebrafish, and the ends mapped by cloning. The excised miR sequences are renamed miR-199a (to avoid confusion with the subsequently identified miR-199b (MI0000282)) and miR-199a* (from the 3' arm) here. The two putative hairpin precursors in human map to chromosome 19 (mir-199a-1, MI0000242) and chromosome 1 (mir-199a-2, MI0000281). Landgraf et al. show that both mature products are expressed, prompting the renaming to miR-199a-5p and miR-199a-3p [4]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-199a-5p |
|
Accession | MIMAT0000231 |
Previous IDs | hsa-miR-199a |
Sequence |
6 - cccaguguucagacuaccuguuc - 28 |
Deep sequencing | 1830012 reads, 149 experiments |
Evidence | experimental; cloned [2-4] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-199a-3p |
|
Accession | MIMAT0000232 |
Previous IDs | hsa-miR-199a* |
Sequence |
47 - acaguagucugcacauugguua - 68 |
Deep sequencing | 9969596 reads, 159 experiments |
Evidence | experimental; cloned [4], Illumina [5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12554859
"New microRNAs from mouse and human"
RNA. 9:175-179(2003).
|
2 |
PMID:12624257
"Vertebrate microRNA genes"
Science. 299:1540(2003).
|
3 |
PMID:15978578
"Identification of human fetal liver miRNAs by a novel method"
FEBS Lett. 579:3849-3854(2005).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |