![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-203 |
||||||
Accession | MI0000246 (change log) | |||||
Symbol | MGI:Mir203 | |||||
Description | Mus musculus miR-203 stem-loop | |||||
Gene family | MIPF0000108; mir-203 | |||||
Literature search |
![]()
103 open access papers mention mmu-mir-203 | |||||
Stem-loop |
u c u g a c 5' gcc gguc agugguucu gaca uuca caguu ugu ||| |||| ||||||||| |||| |||| ||||| || a 3' cgg ccag ucaccagga uugu aagu guuaa acg c a u a - c |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-203-5p |
|
Accession | MIMAT0004547 |
Previous IDs | mmu-miR-203* |
Sequence |
10 - agugguucuugacaguucaaca - 31 |
Deep sequencing | 1688 reads, 54 experiments |
Evidence | experimental; cloned [2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-203-3p |
|
Accession | MIMAT0000236 |
Previous IDs | mmu-miR-203 |
Sequence |
48 - gugaaauguuuaggaccacuag - 69 |
Deep sequencing | 242470 reads, 101 experiments |
Evidence | experimental; cloned [1-2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12554859
"New microRNAs from mouse and human"
RNA. 9:175-179(2003).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|