Stem-loop sequence hsa-mir-30d

Accession

MI0000255 (change log)

Symbol

HGNC:MIR30D

Description

Homo sapiens miR-30d stem-loop

Gene family

MIPF0000005; mir-30

Literature search

380 open access papers mention hsa-mir-30d
(1534 sentences)

Stem-loop

   guu  u         ccc           gua  ac 
5'    gu guaaacauc   gacuggaagcu   ag  a
      || |||||||||   |||||||||||   ||   
3'    cg cguuuguag   cugacuuucga   uc  c
   cau  u         --a           --a  ga 

Deep sequencing

8215364 reads, 1.17e+04 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr8: 134804876-134804945 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000379148 ; CTD-2588J1.1-001; intron 1

  ENST00000517695 ; CTD-2588J1.1-001; intron 1

Clustered miRNAs

< 10kb from hsa-mir-30d

• hsa-mir-30d: chr8: 134804876-134804945 [-]
• hsa-mir-30b: chr8: 134800520-134800607 [-]

Database links

• EntrezGene:MIR30D
• HGNC:MIR30D
• RNAcentral:URS000036BDAF_9606
• miRBase Tracker:MI0000255

Mature sequence hsa-miR-30d-5p

• Accession: MIMAT0000245
• Previous IDs: hsa-miR-30d
• Sequence: 6 - uguaaacauccccgacuggaag - 27
• Deep sequencing: 7750434 reads, 159 experiments
• Evidence: experimental; cloned [2-4]
• Database links:
  • RNAcentral:URS000005CF5F_9606
• Predicted targets:
  • TargetMiner:hsa-miR-30d-5p
  • TargetScanVert:hsa-miR-30d-5p
  • miRDB:hsa-miR-30d-5p
  • microrna.org:hsa-miR-30d-5p

Mature sequence hsa-miR-30d-3p

• Accession: MIMAT0004551
• Previous IDs: hsa-miR-30d*
• Sequence: 46 - cuuucagucagauguuugcugc - 67
• Deep sequencing: 464895 reads, 157 experiments
• Evidence: experimental; cloned [2]
• Database links:
  • RNAcentral:URS00004B2A47_9606
• Predicted targets:
  • TargetMiner:hsa-miR-30d-3p
  • TargetScanVert:hsa-miR-30d-3p
  • miRDB:hsa-miR-30d-3p
  • microrna.org:hsa-miR-30d-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
4. PMID:17989717 "Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis" Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A Leukemia. 22:330-338(2008).