![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-30d |
||||||
Accession | MI0000255 (change log) | |||||
Symbol | HGNC:MIR30D | |||||
Description | Homo sapiens miR-30d stem-loop | |||||
Gene family | MIPF0000005; mir-30 | |||||
Literature search |
![]()
380 open access papers mention hsa-mir-30d | |||||
Stem-loop |
guu u ccc gua ac 5' gu guaaacauc gacuggaagcu ag a || ||||||||| ||||||||||| || 3' cg cguuuguag cugacuuucga uc c cau u --a --a ga |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-30d-5p |
|
Accession | MIMAT0000245 |
Previous IDs | hsa-miR-30d |
Sequence |
6 - uguaaacauccccgacuggaag - 27 |
Deep sequencing | 7750434 reads, 159 experiments |
Evidence | experimental; cloned [2-4] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-30d-3p |
|
Accession | MIMAT0004551 |
Previous IDs | hsa-miR-30d* |
Sequence |
46 - cuuucagucagauguuugcugc - 67 |
Deep sequencing | 464895 reads, 157 experiments |
Evidence | experimental; cloned [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|
4 |