![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-122 |
||||||
Accession | MI0000256 (change log) | |||||
Previous IDs | mmu-mir-122a | |||||
Symbol | MGI:Mir122 | |||||
Description | Mus musculus miR-122 stem-loop | |||||
Gene family | MIPF0000095; mir-122 | |||||
Literature search |
![]()
264 open access papers mention mmu-mir-122 | |||||
Stem-loop |
gg c - uc 5' agcugu aguguga aaugguguuug ug c |||||| ||||||| ||||||||||| || a 3' ucgaua ucacacu uuaccgcaaac ac a aa a u ca |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-122-5p |
|
Accession | MIMAT0000246 |
Previous IDs | mmu-miR-122a;mmu-miR-122 |
Sequence |
6 - uggagugugacaaugguguuug - 27 |
Deep sequencing | 3729985 reads, 93 experiments |
Evidence | experimental; cloned [1-2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-122-3p |
|
Accession | MIMAT0017005 |
Previous IDs | mmu-miR-122* |
Sequence |
41 - aaacgccauuaucacacuaaau - 62 |
Deep sequencing | 529 reads, 20 experiments |
Evidence | experimental; Illumina [4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|