Stem-loop sequence hsa-mir-7-1

Accession MI0000263
Symbol HGNC:MIR7-1
Description Homo sapiens miR-7-1 stem-loop
Gene family MIPF0000022; mir-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

This family represents the microRNA (miRNA) precursor mir-7. This miRNA has been predicted or experimentally confirmed in a wide range of species. miRNAs are transcribed as ~70 nucleotide precursors (modelled here) and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The involvement of Dicer in miRNA processing suggests a relationship with the phenomenon of RNA interference. Mature miRNA-7 is derived from three microRNA precursors in the human genome, miR-7-1, miR-7-2 and miR-7-3. miRNAs are numbered based on the sequence of the mature RNA. miR-7 is directly regulated by the transcription factor HoxD10. miRNAs are thought to have regulatory roles through complementarity to mRNA. miR-7 is essential for the maintenance of regulatory stability under conditions of environmental flux. It plays an important role in controlling mRNA expression. The miR-7 gene is found in most sequenced Urbilateria species, and the sequence of its mature miRNA product is perfectly conserved from annelids to humans, indicating a strong functional conservation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--u    u  -      a  u        a     a       u      --     a 
   ugga gu uggccu gu cugugugg agacu gugauuu guuguu  uuuag u
   |||| || |||||| || |||||||| ||||| ||||||| ||||||  |||||  
   aucu cg accgga ca gguauacc ucuga cacuaaa caacag  aaauc a
gac    c  u      -  c        g     -       -      cu     a 
Get sequence
Deep sequencing
3143 reads, 48 experiments
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr9: 86584663-86584772 [-]
sense
OTTHUMT00000052851 ; HNRNPK-007; intron 1
OTTHUMT00000052851 ; HNRNPK-007; intron 1
OTTHUMT00000052851 ; HNRNPK-007; intron 1
OTTHUMT00000052854 ; HNRNPK-010; exon 2
OTTHUMT00000052854 ; HNRNPK-010; exon 2
OTTHUMT00000052854 ; HNRNPK-010; exon 2
OTTHUMT00000052853 ; HNRNPK-009; intron 3
OTTHUMT00000052853 ; HNRNPK-009; intron 3
OTTHUMT00000052853 ; HNRNPK-009; intron 3
OTTHUMT00000052845 ; HNRNPK-001; intron 15
OTTHUMT00000052847 ; HNRNPK-003; intron 15
OTTHUMT00000052856 ; HNRNPK-012; intron 15
OTTHUMT00000052845 ; HNRNPK-001; intron 15
OTTHUMT00000052847 ; HNRNPK-003; intron 15
OTTHUMT00000052856 ; HNRNPK-012; intron 15
OTTHUMT00000052845 ; HNRNPK-001; intron 15
OTTHUMT00000052847 ; HNRNPK-003; intron 15
OTTHUMT00000052856 ; HNRNPK-012; intron 15
OTTHUMT00000052846 ; HNRNPK-002; intron 16
OTTHUMT00000052855 ; HNRNPK-011; intron 16
OTTHUMT00000052846 ; HNRNPK-002; intron 16
OTTHUMT00000052855 ; HNRNPK-011; intron 16
OTTHUMT00000052846 ; HNRNPK-002; intron 16
OTTHUMT00000052855 ; HNRNPK-011; intron 16
ENST00000493362 ; HNRNPK-007; intron 1
ENST00000493362 ; HNRNPK-007; intron 1
ENST00000493362 ; HNRNPK-007; intron 1
ENST00000481820 ; HNRNPK-010; exon 2
ENST00000481820 ; HNRNPK-010; exon 2
ENST00000481820 ; HNRNPK-010; exon 2
ENST00000492865 ; HNRNPK-009; intron 3
ENST00000492865 ; HNRNPK-009; intron 3
ENST00000492865 ; HNRNPK-009; intron 3
ENST00000376268 ; HNRNPK-003; intron 15
ENST00000351839 ; HNRNPK-012; intron 15
ENST00000435158 ; HNRNPK-001; intron 15
ENST00000376258 ; HNRNPK-201; intron 15
ENST00000376268 ; HNRNPK-003; intron 15
ENST00000351839 ; HNRNPK-012; intron 15
ENST00000435158 ; HNRNPK-001; intron 15
ENST00000376258 ; HNRNPK-201; intron 15
ENST00000376268 ; HNRNPK-003; intron 15
ENST00000351839 ; HNRNPK-012; intron 15
ENST00000435158 ; HNRNPK-001; intron 15
ENST00000376281 ; HNRNPK-011; intron 16
ENST00000360384 ; HNRNPK-002; intron 16
ENST00000376264 ; HNRNPK-203; intron 16
ENST00000376263 ; HNRNPK-202; intron 16
ENST00000376281 ; HNRNPK-011; intron 16
ENST00000360384 ; HNRNPK-002; intron 16
ENST00000376264 ; HNRNPK-203; intron 16
ENST00000376263 ; HNRNPK-202; intron 16
ENST00000376281 ; HNRNPK-011; intron 16
ENST00000360384 ; HNRNPK-002; intron 16
ENST00000376264 ; HNRNPK-202; intron 16
ENST00000376263 ; HNRNPK-201; intron 16
Database links

Mature sequence hsa-miR-7-5p

Accession MIMAT0000252
Previous IDs hsa-miR-7
Sequence

24 - 

uggaagacuagugauuuuguugu

 - 46

Get sequence
Deep sequencing 8099 reads, 46 experiments
Evidence experimental; cloned [2-3]
Validated targets
Predicted targets

Mature sequence hsa-miR-7-1-3p

Accession MIMAT0004553
Previous IDs hsa-miR-7-1*
Sequence

66 - 

caacaaaucacagucugccaua

 - 87

Get sequence
Deep sequencing 287 reads, 21 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).