Stem-loop sequence hsa-mir-181a-2

AccessionMI0000269
Previous IDshsa-mir-181a
Symbol HGNC:MIR181A2
DescriptionHomo sapiens miR-181a-2 stem-loop
Gene family MIPF0000007; mir-181
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-181_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-181 microRNA precursor is a small non-coding RNA molecule. MicroRNAs (miRNAs) are transcribed as ~70 nucleotide precursors and subsequently processed by the RNase-III type enzyme Dicer to give a ~22 nucleotide mature product. In this case the mature sequence comes from the 5' arm of the precursor. They target and modulate protein expression by inhibiting translation and / or inducing degradation of target messenger RNAs. This new class of genes has recently been shown to play a central role in malignant transformation. miRNA are downregulated in many tumors and thus appear to function as tumor suppressor genes. The mature products miR-181a, miR-181b, miR-181c or miR-181d are thought to have regulatory roles at posttranscriptional level, through complementarity to target mRNAs. miR-181 which has been predicted or experimentally confirmed in a wide number of vertebrate species as rat, zebrafish, and in the pufferfish (see below) (MIPF0000007).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   agaagggcuaucaggccagccuuca             a   u      cu       a    ggga 
5'                          gaggacuccaagg aca ucaacg  gucggug guuu    u
                            ||||||||||||| ||| ||||||  ||||||| ||||    u
3'                          uuccugggguucc ugu aguugc  cagucac caaa    u
   ------------------------a             a   c      --       -    aaag 
Get sequence
Deep sequencing
704567 reads, 7.01e+03 reads per million, 74 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. and Lui et al. later verify expression in human [4-5].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr9: 124692442-124692551 [+]
antisense
OTTHUMT00000053903 ; C9orf148-001; intron 1
OTTHUMT00000106443 ; TTLL11-003; intron 5
OTTHUMT00000053906 ; TTLL11-001; intron 6
ENST00000411790 ; TTLL11-IT1-001; intron 1
ENST00000474723 ; TTLL11-003; intron 5
ENST00000373778 ; TTLL11-001; intron 6
ENST00000321582 ; TTLL11-201; intron 6
Clustered miRNAs
< 10kb from hsa-mir-181a-2
hsa-mir-181a-2chr9: 124692442-124692551 [+]
hsa-mir-181b-2chr9: 124693710-124693798 [+]
Database links

Mature sequence hsa-miR-181a-5p

Accession MIMAT0000256
Previous IDshsa-miR-181a
Sequence

39 - 

aacauucaacgcugucggugagu

 - 61

Get sequence
Deep sequencing103974 reads, 64 experiments
Evidence experimental; cloned [2,4-6]
Validated targets
Predicted targets

Mature sequence hsa-miR-181a-2-3p

Accession MIMAT0004558
Previous IDshsa-miR-181a-2*
Sequence

77 - 

accacugaccguugacuguacc

 - 98

Get sequence
Deep sequencing7495 reads, 44 experiments
Evidence experimental; cloned [4]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
6
PMID:17989717 "Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis" Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A Leukemia. 22:330-338(2008).