![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-181c |
||||||
Accession | MI0000271 (change log) | |||||
Symbol | HGNC:MIR181C | |||||
Description | Homo sapiens miR-181c stem-loop | |||||
Gene family | MIPF0000007; mir-181 | |||||
Literature search |
![]()
279 open access papers mention hsa-mir-181c | |||||
Stem-loop |
c -aaauuug a g ug gaa cu a ggca 5' gga cca gg uu ggg cauucaac gucggug guuug g ||| ||| || || ||| |||||||| ||||||| ||||| c 3' ccu ggu cc ga ccc gugaguug cagcuac caaac u u accguuaa - g gu -ag -c - ggac |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. confirm the expression of miR-181c in human [2]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-181c-5p |
|
Accession | MIMAT0000258 |
Previous IDs | hsa-miR-181c |
Sequence |
27 - aacauucaaccugucggugagu - 48 |
Deep sequencing | 86561 reads, 157 experiments |
Evidence | experimental; cloned [2] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-181c-3p |
|
Accession | MIMAT0004559 |
Previous IDs | hsa-miR-181c* |
Sequence |
65 - aaccaucgaccguugaguggac - 86 |
Deep sequencing | 26397 reads, 153 experiments |
Evidence | experimental; cloned [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12624257
"Vertebrate microRNA genes"
Science. 299:1540(2003).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|