miRBase entry: hsa-mir-182

Stem-loop hsa-mir-182


Accession
MI0000272
Symbol
HGNC: MIR182
Description
Homo sapiens hsa-mir-182 precursor miRNA mir-182
Gene
family?
RF00702; mir-182

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR182 is a microRNA implicated in various human cancers, where it often acts as an oncogene [PMC5308578]. In a study involving a reduced model with four predictors, MIR182 was one of the factors considered, alongside Age, miR21, and β-CTx [PMC9713074]. Overexpression of MIR182 has been observed to inhibit apoptosis in oral squamous cell carcinoma (OSCC) cells and conversely, its inhibition was shown to promote apoptosis in Tca8113 OSCC cells [PMC5308578]. MIR182 is not only upregulated in OSCC but also in several other cancers including breast cancer, where it is elevated both in tumor tissues and the serum of patients [PMC5308578]. Despite some controversy regarding its role in lung cancer, increased levels of MIR182 have been detected in lung cancer cells and tissues as well [PMC5308578'>PMC5308578]. Furthermore, upregulation of MIR182 has been documented across various other cancers such as melanoma, glioma tumors, ovarian cancer, colorectal cancer, and prostate cancer; this upregulation contributes to tumor cell survival and metastatic behaviors [PMC5308578]. The oncogenic function of MIR182 has been linked to its regulation of RASA1 and SPRED1 genes that are involved with Ras activation pathways within OSCC [PMC5308578].

Literature search
290 open access papers mention hsa-mir-182
(2366 sentences)

Sequence

86555 reads, 272 reads per million, 146 experiments
gagcugcuugccuccccccguuUUUGGCAAUGGUAGAACUCACACUggugagguaacaggauccggUGGUUCUAGACUUGCCAACUAuggggcgaggacucagccggcac
..((((((.(((((.((((((..(((((((...((((((...((((((..............))))))))))))...)))))))..)))))).)))).)..)).))))..

Structure
ga    -  -u -    c      uU       UGG      UCA      ugaggu 
  gcug cu  g ccuc ccccgu  UUGGCAA   UAGAAC   CACUgg      a
  |||| ||  | |||| ||||||  |||||||   ||||||   ||||||       
  cggc ga  c ggag gggguA  AACCGUU   AUCUUG   GUggcc      a
ca    c  cu a    c      UC       CAG      ---      uaggac 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chr7: 129770383-129770492 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-182
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-182 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-182-5p

Accession MIMAT0000259
Description Homo sapiens hsa-miR-182-5p mature miRNA
Sequence 23 - UUUGGCAAUGGUAGAACUCACACU - 46
Evidence experimental
cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-182-3p

Accession MIMAT0000260
Description Homo sapiens hsa-miR-182-3p mature miRNA
Sequence 67 - UGGUUCUAGACUUGCCAACUA - 87
Evidence not_experimental

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540