Stem-loop sequence hsa-mir-196a-2

AccessionMI0000279 (change log)
Previous IDshsa-mir-196-2
Symbol HGNC:MIR196A2
DescriptionHomo sapiens miR-196a-2 stem-loop
Gene family MIPF0000031; mir-196
Literature search

227 open access papers mention hsa-mir-196a-2
(1241 sentences)

Stem-loop 
   -ug    - -uc       --c                  a          a ug   
5'    cucg c   agcugau   uguggcuuagguaguuuc uguuguuggg u  ag 
      |||| |   |||||||   |||||||||||||||||| |||||||||| |  | u
3'    gagc g   uuggcug   acauugaguccgucaaag acaacggcuc a  uu 
   cgg    u cuu       acu                  a          a gu
Get sequence
Deep sequencing
543057 reads, 1.23e+03 reads per million, 156 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. miR-196a was later validated in human [3,4]. Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 53991738-53991847 [+]
antisense
OTTHUMT00000460684 ; RP11-793H13.10-001; intron 2
OTTHUMT00000406302 ; ATF7-007; intron 2
OTTHUMT00000405834 ; ATF7-001; intron 2
OTTHUMT00000460675 ; ATF7-006; intron 2
OTTHUMT00000460676 ; ATF7-010; intron 2
OTTHUMT00000405836 ; ATF7-005; intron 2
OTTHUMT00000460686 ; ATF7-011; intron 2
OTTHUMT00000460677 ; ATF7-009; intron 2
OTTHUMT00000405837 ; ATF7-002; intron 2
ENST00000328463 ; ATF7-201; intron 1
ENST00000591834 ; RP11-793H13.10-001; intron 2
ENST00000548446 ; ATF7-007; intron 2
ENST00000420353 ; ATF7-001; intron 2
ENST00000456903 ; ATF7-006; intron 2
ENST00000588232 ; ATF7-010; intron 2
ENST00000551480 ; ATF7-005; intron 2
ENST00000588078 ; ATF7-011; intron 2
ENST00000548118 ; ATF7-009; intron 2
ENST00000591397 ; ATF7-002; intron 2
ENST00000415113 ; ATF7-202; intron 2
Database links

Mature sequence hsa-miR-196a-5p

Accession MIMAT0000226
Previous IDshsa-miR-196a
Sequence

25 -  

uagguaguuucauguuguuggg

 - 46

Get sequence
Deep sequencing1120852 reads, 155 experiments
Evidence experimental; cloned [3-5]
Database links
Predicted targets

Mature sequence hsa-miR-196a-3p

Accession MIMAT0004562
Previous IDshsa-miR-196a*
Sequence

62 -  

cggcaacaagaaacugccugag

 - 83

Get sequence
Deep sequencing8077 reads, 80 experiments
Evidence experimental; cloned [4]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15105502 "MicroRNA-directed cleavage of HOXB8 mRNA" Yekta S, Shih IH, Bartel DP Science. 304:594-596(2004).
3
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).