WARNING: This summary was generated by AI. MIR196A2 is a non-coding RNA involved in the regulation of genes associated with lower limb development and has been implicated in clinical conditions related to infertility and pain severity [PMC4041413]. Specifically, the rs11614913 C allele of MIR196A2 has been linked to an increased risk of infertility with a significance level of p=0.016, and it is also associated with heightened pain severity, as indicated by a p-value of 0.012 [PMC5363543]. Contrasting the effects observed with MIR196A2, SNP rs7372209 in MIR26A1 did not show an association with clinical symptoms, highlighting the unique role that genetic variations in MIR196A2 may play in these conditions [PMC5363543].
-ug - -uc --c A a gag cucg c agcugau uguggcuUAGGUAGUUUC UGUUGUUGGG uu u |||| | ||||||| |||||||||||||||||| |||||||||| || gagc g uuggcug acauuGAGUCCGUCAAAG ACAACGGCuc aa u cgg u cuu acu A - guu
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000226 |
| Description | Homo sapiens hsa-miR-196a-5p mature miRNA |
| Sequence | 25 - UAGGUAGUUUCAUGUUGUUGGG - 46 |
| Evidence |
experimental
cloned [3-5] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004562 |
| Description | Homo sapiens hsa-miR-196a-3p mature miRNA |
| Sequence | 62 - CGGCAACAAGAAACUGCCUGAG - 83 |
| Evidence |
experimental
cloned [4] |
| Database links |
|
| Predicted targets |
|
|