![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-196a-2 |
|||||
Accession | MI0000279 (change log) | ||||
Previous IDs | hsa-mir-196-2 | ||||
Symbol | HGNC:MIR196A2 | ||||
Description | Homo sapiens miR-196a-2 stem-loop | ||||
Gene family | MIPF0000031; mir-196 | ||||
Literature search |
![]()
227 open access papers mention hsa-mir-196a-2 | ||||
Stem-loop |
-ug - -uc --c a a ug 5' cucg c agcugau uguggcuuagguaguuuc uguuguuggg u ag |||| | ||||||| |||||||||||||||||| |||||||||| | | u 3' gagc g uuggcug acauugaguccgucaaag acaacggcuc a uu cgg u cuu acu a a gu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. miR-196a was later validated in human [3,4]. Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-196a-5p |
|
Accession | MIMAT0000226 |
Previous IDs | hsa-miR-196a |
Sequence |
25 - uagguaguuucauguuguuggg - 46 |
Deep sequencing | 1120852 reads, 155 experiments |
Evidence | experimental; cloned [3-5] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-196a-3p |
|
Accession | MIMAT0004562 |
Previous IDs | hsa-miR-196a* |
Sequence |
62 - cggcaacaagaaacugccugag - 83 |
Deep sequencing | 8077 reads, 80 experiments |
Evidence | experimental; cloned [4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12624257
"Vertebrate microRNA genes"
Science. 299:1540(2003).
|
2 |
PMID:15105502
"MicroRNA-directed cleavage of HOXB8 mRNA"
Science. 304:594-596(2004).
|
3 |
PMID:12554859
"New microRNAs from mouse and human"
RNA. 9:175-179(2003).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|