Stem-loop sequence hsa-mir-181a-1

AccessionMI0000289 (change log)
Previous IDshsa-mir-213
Symbol HGNC:MIR181A1
DescriptionHomo sapiens miR-181a-1 stem-loop
Gene family MIPF0000007; mir-181
Literature search

486 open access papers mention hsa-mir-181a-1
(2544 sentences)

Stem-loop
   -u    -uu   -    -   uc  u a   u      cu       a    g  au 
5'   gagu   uga gguu gcu  ag g aca ucaacg  gucggug guuu ga  u
     ||||   ||| |||| |||  || | ||| ||||||  ||||||| |||| ||  a
3'   cuca   acu ccaa cgg  uc c ugu aguugc  cagcuac caaa cu  a
   ac    ucu   a    u   ua  c a   u      --       -    a  aa 
Get sequence
Deep sequencing
2955985 reads, 3.61e+03 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 198859044-198859153 [-]
sense
OTTHUMT00000087434 ; RP11-31E23.1-001; intron 2
ENST00000432296 ; MIR181A1HG-001; intron 2
Clustered miRNAs
< 10kb from hsa-mir-181a-1
hsa-mir-181a-1chr1: 198859044-198859153 [-]
hsa-mir-181b-1chr1: 198858873-198858982 [-]
Database links

Mature sequence hsa-miR-181a-5p

Accession MIMAT0000256
Previous IDshsa-miR-181a
Sequence

24 - 

aacauucaacgcugucggugagu

 - 46

Get sequence
Deep sequencing5859734 reads, 159 experiments
Evidence experimental; cloned [2,4-6]
Database links
Predicted targets

Mature sequence hsa-miR-181a-3p

Accession MIMAT0000270
Previous IDshsa-miR-213;hsa-miR-181a*
Sequence

64 - 

accaucgaccguugauuguacc

 - 85

Get sequence
Deep sequencing26089 reads, 154 experiments
Evidence experimental; cloned [4]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
6
PMID:17989717 "Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis" Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A Leukemia. 22:330-338(2008).