Stem-loop sequence hsa-mir-215

AccessionMI0000291
Symbol HGNC:MIR215
DescriptionHomo sapiens miR-215 stem-loop
Gene family MIPF0000063; mir-192
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-192/215_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-192 microRNA precursor (homologous to miR-215), is a short non-coding RNA gene involved in gene regulation. miR-192 and miR-215 have now been predicted or experimentally confirmed in mouse and human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-192 and mir-215 are thought to be positive regulators of p53, a human tumour suppressor. They are also overexpressed in gastric cancer, and could potentially be used as biomarkers or therapeutic targets. It has also been suggested that mir-192 could be used as a biomarker for drug-induced liver damage.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   aucauuca   a      ------      a a  a    -u   u          uaua 
5'         gaa ugguau      acagga a ug ccua  gaa ugacagacaa    g
           ||| ||||||      |||||| | || ||||  ||| ||||||||||    c
3'         cuu aucgug      ugucuu u ac ggau  cuu acugucuguu    u
   ------aa   c      ucagua      a a  c    uu   u          ugag 
Get sequence
Deep sequencing
21333 reads, 1.95e+03 reads per million, 69 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr1: 220117853-220117962 [-]
sense
OTTHUMT00000098802 ; SLC30A10-002; intron 1
ENST00000484239 ; SLC30A10-002; intron 1
ENST00000536446 ; SLC30A10-201; intron 1
Clustered miRNAs
< 10kb from hsa-mir-215
hsa-mir-194-1chr1: 220118157-220118241 [-]
hsa-mir-215chr1: 220117853-220117962 [-]
Database links

Mature sequence hsa-miR-215-5p

Accession MIMAT0000272
Sequence

27 - 

augaccuaugaauugacagac

 - 47

Get sequence
Deep sequencing378 reads, 32 experiments
Evidence experimental; cloned [2], Illumina [3]
Validated targets
Predicted targets

Mature sequence hsa-miR-215-3p

Accession MIMAT0026476
Sequence

64 - 

ucugucauuucuuuaggccaaua

 - 86

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [3]

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).