Stem-loop sequence hsa-mir-216a

Accession

MI0000292 (change log)

Previous IDs

hsa-mir-216

Symbol

HGNC:MIR216A

Description

Homo sapiens miR-216a stem-loop

Gene family

MIPF0000054; mir-216

Stem-loop

   ----  u     u   ----------     u         cu   a        ---a   u 
5'     ga ggcug gag          uuggc uaaucucag  ggc acugugag    ugu c
       || ||||| |||          ||||| |||||||||  ||| ||||||||    |||  
3'     cu ccgau cuu          aaucg auuaggguc  cug ugacacuc    aca a
   agca  c     c   uaacgagaca     u         -u   g        ccua   u 

Deep sequencing

111359 reads, 1.29e+03 reads per million, 28 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr2: 55988950-55989059 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hsa-mir-216a

• hsa-mir-216a: chr2: 55988950-55989059 [-]
• hsa-mir-217: chr2: 55982967-55983076 [-]

Database links

• EntrezGene:MIR216A
• HGNC:MIR216A
• RNAcentral:URS000013ABA3_9606
• miRBase Tracker:MI0000292

Mature sequence hsa-miR-216a-5p

• Accession: MIMAT0000273
• Previous IDs: hsa-miR-216;hsa-miR-216a
• Sequence: 19 - uaaucucagcuggcaacuguga - 40
• Deep sequencing: 104439 reads, 25 experiments
• Evidence: experimental; cloned [2], SOLiD [3]
• Database links:
  • RNAcentral:URS0000318E24_9606
• Predicted targets:
  • TargetScanVert:hsa-miR-216a-5p
  • miRDB:hsa-miR-216a-5p
  • microrna.org:hsa-miR-216a-5p

Mature sequence hsa-miR-216a-3p

• Accession: MIMAT0022844
• Sequence: 58 - ucacaguggucucugggauuau - 79
• Deep sequencing: 6703 reads, 14 experiments
• Evidence: experimental; SOLiD [3]
• Predicted targets:
  • TargetScanVert:hsa-miR-216a-3p
  • miRDB:hsa-miR-216a-3p

References

1. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).