Stem-loop sequence hsa-mir-218-2

AccessionMI0000295
Symbol HGNC:MIR218-2
DescriptionHomo sapiens miR-218-2 stem-loop
Gene family MIPF0000026; mir-218
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-218_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-218 microRNA precursor is a small non-coding RNA that regulates gene expression by antisense binding. miR-218 appears to be a vertebrate specific microRNA and has now been predicted and experimentally confirmed in a wide range of vertebrate species. The extents of the hairpin precursors are not known. In this case the mature sequence in excised from the 5'arm of the hairpin. miR-218, along with miR-585, has been found to be silenced by DNA methylation in oral squamous cell carcinoma. It is also downregulated in Nasopharyngeal carcinoma, with artificially-induced expression serving to slow tumour growth. miR-218 has also been found to have tumour suppressing qualities in bladder cancer cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   gac   --uc  u    g       uuu         cu        gguggaacga  g 
5'    cag    gc gcgg gcuuucc   gugcuugau  aaccaugu          ug a
      |||    || |||| |||||||   |||||||||  ||||||||          ||  
3'    guc    cg ugcc cgaaagg   cacgaacug  uugguaca          gc a
   -ac   cucu  -    a       cgc         uc        --------ag  a 
Get sequence
Deep sequencing
2637 reads, 1.38e+03 reads per million, 51 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr5: 168768146-168768255 [-]
intergenic
Database links

Mature sequence hsa-miR-218-5p

Accession MIMAT0000275
Previous IDshsa-miR-218
Sequence

25 - 

uugugcuugaucuaaccaugu

 - 45

Get sequence
Deep sequencing1018 reads, 39 experiments
Evidence experimental; cloned [2-3]
Validated targets
Predicted targets

Mature sequence hsa-miR-218-2-3p

Accession MIMAT0004566
Previous IDshsa-miR-218-2*
Sequence

67 - 

caugguucugucaagcaccgcg

 - 88

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).