miRBase entry: hsa-mir-219a-1

Stem-loop hsa-mir-219a-1


Accession
MI0000296
Symbol
HGNC: MIR219A1
Description
Homo sapiens hsa-mir-219a-1 precursor miRNA mir-219
Gene
family?
RF00251; mir-219

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR219A1 is a microRNA gene located within a 200 kb region on chromosome 6, which is associated with several genes including HLA-DPA1, HLA-DPB1, and COL11A2 [PMC10016042]. This microRNA has been observed to be downregulated in the cortex of Alzheimer's disease (AD) patients [PMC7564652]. The downregulation of MIR219A1 in AD is consistent with previous findings, as it has been reported to be downregulated in the brain of AD patients [PMC7564652]. MIR219A1 is known to target Tau protein and its phosphorylation, which are critical processes in the development of AD pathology [PMC7564652]. The dysregulation of MIR219A1 and other miRNAs like MIR29B1 and MIR129-2 has been confirmed in the cortex of AD patients, indicating their potential role in the disease's progression [PMC7564652]. Although its exact role in AD is not fully clear, it has been shown that MIR219A1 expression decreases by 9-fold in affected individuals [PMC7564652]. Additionally, single nucleotide polymorphisms (SNPs) within MIR219A1 have shown significant associations with AD, suggesting a genetic component to its involvement with the disease [PMC4895015]. Changes in expression patterns of miRNAs including MIR219A1 have been observed across studies on neurodegenerative diseases like Alzheimer's [PMC9702351].

Literature search
70 open access papers mention hsa-mir-219a-1
(248 sentences)

Sequence

1339 reads, 9 reads per million, 84 experiments
ccgccccgggccgcggcuccUGAUUGUCCAAACGCAAUUCUcgagucuauggcuccggccgAGAGUUGAGUCUGGACGUCCCGagccgccgcccccaaaccucgagcggg
((((.(.((((.(((((((..(((.(((((.((.(((((((((.(((.........)))))))))))).)).))))))))..))))))).)))).........).)))).

Structure
-    c --------c    c       cU   U     A  G         a   uau 
 ccgc c         gggc gcggcuc  GAU GUCCA AC CAAUUCUcg guc   g
 |||| |         |||| |||||||  ||| ||||| || ||||||||| |||   g
 ggcg g         cccg cgccgaG  CUG CAGGU UG GUUGAGAgc cgg   c
g    a cuccaaacc    c       CC   -     C  A         -   ccu 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the 5' excised miR has been validated in zebrafish, and the 5' end mapped by PCR [2]. The mature products were later validated in human [3]. Two hairpin precursor structures are predicted, mir-219-1 on chromosome 6 (MIR:MI0000296) and mir-219-2 on chromosome 9 (MIR:MI0000740) [2].

Genome context
chr6: 33207835-33207944 [+]

Disease association
hsa-mir-219a-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-219a-5p

Accession MIMAT0000276
Description Homo sapiens hsa-miR-219a-5p mature miRNA
Sequence 21 - UGAUUGUCCAAACGCAAUUCU - 41
Evidence experimental
cloned [3]
Database links
Predicted targets

Mature hsa-miR-219a-1-3p

Accession MIMAT0004567
Description Homo sapiens hsa-miR-219a-1-3p mature miRNA
Sequence 62 - AGAGUUGAGUCUGGACGUCCCG - 83
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  3. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73