Stem-loop sequence cel-mir-228

AccessionMI0000303 (change log)
DescriptionCaenorhabditis elegans miR-228 stem-loop
Gene family MIPF0000292; mir-228
Literature search

10 open access papers mention cel-mir-228
(28 sentences)

Stem-loop
   -----       -        a    c    c    a   a   -  aug a 
5'      ccuuauc ccguucgc augg acug auga uuc cgg cu   c u
        ||||||| |||||||| |||| |||| |||| ||| ||| ||   | a
3'      ggaguag ggcaggcg uacc uggc uacu agg gcc ga   g a
   uaauu       u        a    a    a    -   c   a  -ca c 
Get sequence
Deep sequencing
4405924 reads, 2.01e+04 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This precursor sequence was predicted by comparative computational approaches [1,2]. Northern blotting confirmed that the strand containing the predicted miR is predominantly expressed, and the 5' and 3' ends were confirmed later [4].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 5562025-5562122 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-228
cel-mir-228chrIV: 5562025-5562122 [+]
cel-mir-790chrIV: 5566422-5566491 [+]
Database links

Mature sequence cel-miR-228-5p

Accession MIMAT0000283
Previous IDscel-miR-228
Sequence

16 - 

aauggcacugcaugaauucacgg

 - 38

Get sequence
Deep sequencing4400928 reads, 17 experiments
Evidence experimental; cloned [1], Northern [1,3], PCR [3], 454 [4], Illumina [5,7], CLIPseq [6]
Database links
Predicted targets

Mature sequence cel-miR-228-3p

Accession MIMAT0020327
Previous IDscel-miR-228*
Sequence

58 - 

gcggaucauacgguaccauagc

 - 79

Get sequence
Deep sequencing4954 reads, 15 experiments
Evidence experimental; Illumina [7]
Database links

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
3
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).
4
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5
6
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
7