miRBase entry: cel-mir-233

Stem-loop cel-mir-233


Accession
MI0000308
Description
Caenorhabditis elegans cel-mir-233 precursor miRNA
Gene family
MIPF0000312; mir-233

Literature search
5 open access papers mention cel-mir-233
(107 sentences)

Sequence

15880 reads, 292 reads per million, 15 experiments
auauagcaucuuucugucUCGCCCAUCCCGUUGCUCCAAUAuucuaacaacaagugauuaUUGAGCAAUGCGCAUGUGCGGGAuagacugauggcugc
...(((((((..((((((((((.(((.(((((((((.((((.((...........)).)))))))))))).).))).))))))))))..))).)))).

Structure
aua    -   uu          C   C -        C    u  uaac 
   uagc auc  ucugucUCGC CAU C CGUUGCUC AAUA uc    a
   |||| |||  |||||||||| ||| | |||||||| |||| ||    a
   gucg uag  agauAGGGCG GUA G GUAACGAG UUau ag    c
--c    g   uc          U   C C        -    u  ugaa 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chrX: 12078587-12078684 [-]

Database links

Mature cel-miR-233-3p

Accession MIMAT0000288
Description Caenorhabditis elegans cel-miR-233-3p mature miRNA
Sequence 61 - UUGAGCAAUGCGCAUGUGCGGGA - 83
Evidence experimental
cloned [1], Northern [1], 454 [3], Illumina [4,6], CLIPseq [5]
Database links
Predicted targets

Mature cel-miR-233-5p

Accession MIMAT0020329
Description Caenorhabditis elegans cel-miR-233-5p mature miRNA
Sequence 19 - UCGCCCAUCCCGUUGCUCCAAUA - 41
Evidence experimental
Illumina [6]
Database links

References

  1. PubMed ID: 12672692
    The microRNAs of Caenorhabditis elegans
    "Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP"
    "Genes Dev (2003) 17:991-1008

  2. PubMed ID: 12747828
    MicroRNAs and other tiny endogenous RNAs in C. elegans
    "Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D"
    "Curr Biol (2003) 13:807-818

  3. PubMed ID: 17174894
    Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans
    "Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP"
    "Cell (2006) 127:1193-1207

  4. PubMed ID: 19460142
    Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development
    Kato M, de Lencastre A, Pincus Z, Slack FJ
    Genome Biol (2009) 10:R54

  5. PubMed ID: 20062054
    Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans
    "Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW"
    "Nat Struct Mol Biol (2010) 17:173-179

  6. PubMed ID: 21307183
    Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer
    "Warf MB, Johnson WE, Bass BL"
    "RNA (2011) 17:563-577