Stem-loop sequence cel-mir-234

AccessionMI0000309 (change log)
DescriptionCaenorhabditis elegans miR-234 stem-loop
Gene family MIPF0000315; mir-234
Literature search

2 open access papers mention cel-mir-234
(10 sentences)

Stem-loop
   --caaaaaauga     c       ca    u       aaaa    uc 
5'             ucaaa gguauuc  gagu gauaaua    ugcg  a
               ||||| |||||||  |||| |||||||    ||||   
3'             aguuu ccauaag  cucg uuauuau    acgc  g
   auguguaucauc     c       ag    -       -cua    cu 
Get sequence
Deep sequencing
1235 reads, 26.7 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 14466263-14466358 [-]
intergenic
Database links

Mature sequence cel-miR-234-5p

Accession MIMAT0020330
Previous IDscel-miR-234*
Sequence

16 - 

cgguauuccagaguugauaaua

 - 37

Get sequence
Deep sequencing24 reads, 8 experiments
Evidence experimental; Illumina [6]
Database links

Mature sequence cel-miR-234-3p

Accession MIMAT0000289
Previous IDscel-miR-234
Sequence

61 - 

uuauugcucgagaauacccuu

 - 81

Get sequence
Deep sequencing1210 reads, 15 experiments
Evidence experimental; cloned [1], Northern [1], 454 [3], Illumina [4,6], CLIPseq [5]
Database links
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
6