Stem-loop sequence cel-mir-239b

AccessionMI0000315 (change log)
DescriptionCaenorhabditis elegans miR-239b stem-loop
Gene family MIPF0000135; mir-239
Literature search

4 open access papers mention cel-mir-239b
(44 sentences)

Stem-loop
   --------     aga   a          ua         a   -   a  ua 
5'         gcgac   ugc auuuuuguac  cacaaaagu cug guc uu  a
           |||||   ||| ||||||||||  ||||||||| ||| ||| ||   
3'         cguug   acg uaaaaacgug  guguuuuca gac cgg ag  g
   ucuauuuu     --a   g          ug         c   u   -  uu 
Get sequence
Deep sequencing
23102 reads, 53.3 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-239b was predicted by computational analysis and conservation in C. elegans and C. briggsae, and the microRNA confirmed by PCR amplification, cloning and sequencing [1]. A large scale cloning and sequencing study finds two dominant mature miRNA products: the second is 1 nt shorter at the 5' end [3].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 11791302-11791399 [-]
intergenic
Clustered miRNAs
< 10kb from cel-mir-239b
cel-mir-239achrX: 11792445-11792542 [+]
cel-mir-239bchrX: 11791302-11791399 [-]
Database links

Mature sequence cel-miR-239b-5p

Accession MIMAT0000295
Previous IDscel-miR-239b
Sequence

16 - 

uuuguacuacacaaaaguacug

 - 37

Get sequence
Deep sequencing21907 reads, 14 experiments
Evidence experimental; cloned [3], Illumina [4], CLIPseq [5]
Database links
Predicted targets

Mature sequence cel-miR-239b-3p

Accession MIMAT0015115
Previous IDscel-miR-239b*
Sequence

58 - 

gcacuuuuguggugugcaaaaa

 - 79

Get sequence
Deep sequencing36 reads, 9 experiments
Evidence experimental; CLIPseq [5]
Database links
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).