Accession
MI0000315
Description
Caenorhabditis elegans
cel-mir-239b precursor miRNA
Gene family
MIPF0000135;
mir-239
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
Cel-mir-239b is a microRNA (miRNA) that is used as a negative control in various experiments. It has minimal sequence identity with miRNAs in human, mouse, and rat [PMC2699527]. In different studies, cel-mir-239b has been used as a control miRNA in experiments involving the inhibition of miRNAs function [PMC7253519]. It has been co-transfected with different vectors and synthetic miRNAs to assess the effects on gene expression [PMC7253519]. Cel-mir-239b has also been used as a negative control in studies involving the transfection of microRNA mimics and inhibitors [PMC7708977] [PMC9617134] [PMC4260481] [PMC4546478] [PMC3743786]. Additionally, cel-mir-239b has been employed as a negative control in experiments using siRNAs to minimize off-target effects and equalize the total amount of small RNA [PMC8019740] [PMC3572043]. It has also been used as a negative control in studies investigating microRNA expression and gene regulation using mimics or inhibitors of specific miRNAs [PMC6502783] [PMC4308918] [PMC5460990] [ [ [ [ [ [ . In summary, cel-mir-239b is commonly used as a negative control in various experimental settings to assess the specific effects of other miRNAs or RNAi molecules.
Literature search
4 open access papers mention cel-mir-239b
(45 sentences)
(45 sentences)
Sequence
16083
reads,
130
reads per million, 14 experiments
gcgacagaugcaauuUUUGUACUACACAAAAGUACUGgucauuuaaguugaggcucaGCACUUUUGUGGUGUGCAAAAAuggcaaguugcuuuuaucu
(((((...(((.((((((((((..(((((((((.((((((.((......))))).))).)))))))))..)))))))))).))).)))))........
(((((...(((.((((((((((..(((((((((.((((((.((......))))).))).)))))))))..)))))))))).))).)))))........
Structure
-------- aga a UA A - a ua
gcgac ugc auuUUUGUAC CACAAAAGU CUG guc uu a
||||| ||| |||||||||| ||||||||| ||| ||| ||
cguug acg uAAAAACGUG GUGUUUUCA Gac cgg ag g
ucuauuuu --a g UG C u - uu
Annotation confidence
High
Do you think this miRNA is real?
Comments
miR-239b was predicted by computational analysis and conservation in C. elegans and C. briggsae, and the microRNA confirmed by PCR amplification, cloning and sequencing [1]. A large scale cloning and sequencing study finds two dominant mature miRNA products: the second is 1 nt shorter at the 5' end [3].
Genome context
chrX: 11791302-11791399 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from cel-mir-239b
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
Database links
Mature cel-miR-239b-5p
| Accession | MIMAT0000295 |
| Description | Caenorhabditis elegans cel-miR-239b-5p mature miRNA |
| Sequence | 16 - UUUGUACUACACAAAAGUACUG - 37 |
| Evidence |
experimental
cloned [3], Illumina [4], CLIPseq [5] |
| Database links |
|
| Predicted targets |
|
Mature cel-miR-239b-3p
| Accession | MIMAT0015115 |
| Description | Caenorhabditis elegans cel-miR-239b-3p mature miRNA |
| Sequence | 58 - GCACUUUUGUGGUGUGCAAAAA - 79 |
| Evidence |
experimental
CLIPseq [5] |
| Database links |
|
References
|
