Stem-loop sequence cel-mir-245

AccessionMI0000321 (change log)
DescriptionCaenorhabditis elegans miR-245 stem-loop
Gene family MIPF0000257; mir-245
Stem-loop
   cugaauu      ugg           caa  u   u     uuu  uua 
5'        caaugu   agagcuauuug   gg acc aauug   ga   u
          ||||||   |||||||||||   || ||| |||||   ||    
3'        guuacg   ucucgaugaac   cc ugg uuaac   cu   u
   --cguuu      uua           cuc  c   -     --u  uag 
Get sequence
Deep sequencing
2911 reads, 13.3 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 7887371-7887467 [+]
intergenic
Database links

Mature sequence cel-miR-245-5p

Accession MIMAT0020336
Previous IDscel-miR-245*
Sequence

20 - 

gcuauuugcaagguaccuaauug

 - 42

Get sequence
Deep sequencing9 reads, 6 experiments
Evidence experimental; Illumina [5]

Mature sequence cel-miR-245-3p

Accession MIMAT0000301
Previous IDscel-miR-245
Sequence

61 - 

auugguccccuccaaguagcuc

 - 82

Get sequence
Deep sequencing2900 reads, 15 experiments
Evidence experimental; cloned [1-2], Northern [1], Illumina [3,5], CLIPseq [4]
Database links
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3
4
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
5