Stem-loop sequence cel-mir-259

AccessionMI0000336 (change log)
DescriptionCaenorhabditis elegans miR-259 stem-loop
Gene family MIPF0000299; mir-259
Literature search

2 open access papers mention cel-mir-259
(57 sentences)

Stem-loop
   ---uc        --a       a        -  u    u   a   ucuuu 
5'      agucauug   aacgagu aaucucau cc aauc ggu gca     c
        ||||||||   ||||||| |||||||| || |||| ||| |||      
3'      ucagugau   uuguuca uuagggua gg uuag cca cgu     g
   uuuuu        aaa       g        c  u    -   c   uccaa 
Get sequence
Deep sequencing
2757 reads, 250 reads per million, 16 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-259 was predicted by computational analysis and conservation in C. elegans and C. briggsae, and the microRNA confirmed by PCR amplification, cloning and sequencing [1].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrV: 10539025-10539125 [-]
intergenic
Database links

Mature sequence cel-miR-259-5p

Accession MIMAT0000314
Previous IDscel-miR-259
Sequence

19 - 

aaaucucauccuaaucugguagca

 - 42

Get sequence
Deep sequencing2101 reads, 16 experiments
Evidence experimental; cloned [1-3], Illumina [4,6], CLIPseq [5]
Database links
Predicted targets

Mature sequence cel-miR-259-3p

Accession MIMAT0020342
Previous IDscel-miR-259*
Sequence

57 - 

ccaccgauuuggcaugggauugac

 - 80

Get sequence
Deep sequencing654 reads, 13 experiments
Evidence experimental; Illumina [6]
Database links

References

1
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
2
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
6