Stem-loop sequence dme-mir-263a

Accession

MI0000343 (change log)

Previous IDs

dme-mir-263

Description

Drosophila melanogaster miR-263a stem-loop

Gene family

MIPF0000122; mir-263

Literature search

10 open access papers mention dme-mir-263a
(170 sentences)

Stem-loop

   uaga     g   a  ua   g     ga   au       guaauu 
5'     ucucg cac gu  aug cacug  aga  ucacggg      u
       ||||| ||| ||  ||| |||||  |||  |||||||      u
3'     agagc gug ua  uac gugau  ucu  agugccc      u
   aaua     -   g  uc   g     uc   --       aacaua 

Deep sequencing

744172 reads, 4.97e+03 reads per million, 49 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Release_6; GCA_000001215.4): chr2L: 11953410-11953503 [-]
• Overlapping transcripts:

  sense

  FBtr0306899 ; CR43314-RD; exon 2

Database links

• RNAcentral:URS00001F1A0E_7227
• miRBase Tracker:MI0000343

Mature sequence dme-miR-263a-5p

• Accession: MIMAT0000319
• Previous IDs: dme-miR-263a
• Sequence: 18 - aauggcacuggaagaauucacggg - 41
• Deep sequencing: 741987 reads, 49 experiments
• Evidence: experimental; Northern [1], 454 [3-4], Illumina [4]
• Database links:
  • RNAcentral:URS00002FC254_7227
• Predicted targets:
  • TargetScanFly:dme-miR-263a
  • microrna.org:dme-miR-263a-5p

Mature sequence dme-miR-263a-3p

• Accession: MIMAT0020799
• Sequence: 59 - cgugaucucuuaguggcaucua - 80
• Deep sequencing: 2183 reads, 45 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS000016D62E_7227

References

1. PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).
2. PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
3. PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4. PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).