![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence dme-mir-263a |
|||||
Accession | MI0000343 (change log) | ||||
Previous IDs | dme-mir-263 | ||||
Description | Drosophila melanogaster miR-263a stem-loop | ||||
Gene family | MIPF0000122; mir-263 | ||||
Literature search |
![]()
10 open access papers mention dme-mir-263a | ||||
Stem-loop |
uaga g a ua g ga au guaauu 5' ucucg cac gu aug cacug aga ucacggg u ||||| ||| || ||| ||||| ||| ||||||| u 3' agagc gug ua uac gugau ucu agugccc u aaua - g uc g uc -- aacaua |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence dme-miR-263a-5p |
|
Accession | MIMAT0000319 |
Previous IDs | dme-miR-263a |
Sequence |
18 - aauggcacuggaagaauucacggg - 41 |
Deep sequencing | 741987 reads, 49 experiments |
Evidence | experimental; Northern [1], 454 [3-4], Illumina [4] |
Database links |
|
Predicted targets |
|
Mature sequence dme-miR-263a-3p |
|
Accession | MIMAT0020799 |
Sequence |
59 - cgugaucucuuaguggcaucua - 80 |
Deep sequencing | 2183 reads, 45 experiments |
Evidence | not experimental |
Database links |
|
References |
|
1 |
PMID:12769849
"Computational and experimental identification of C. elegans microRNAs"
Mol Cell. 11:1253-1263(2003).
|
2 |
PMID:12844358
"Computational identification of Drosophila microRNA genes"
Genome Biol. 4:R42(2003).
|
3 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
4 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|