Stem-loop cel-mir-266

Accession

MI0000346

Description

Caenorhabditis elegans cel-mir-266 precursor miRNA

Gene family

MIPF0000281; mir-266

Literature search

1 open access papers mention cel-mir-266
(7 sentences)

Sequence

17 reads, 4 reads per million, 10 experiments

ugucuaaacuugggcaaaaguuAGGCAAGACUUUGGCAAAGCuugaauccaaguuuugccaaaguuuugcccaacuuuugcccaaauucagcca
.........(((((((((((((.((((((((((((((((((((((....)))))))))))))))))))))).))))))))))))).........

Structure

ugucuaaac             A                      a 
         uugggcaaaaguu GGCAAGACUUUGGCAAAGCuug a
         ||||||||||||| ||||||||||||||||||||||  
         aacccguuuucaa ccguuuugaaaccguuuugaac u
accgacuua             c                      c 

Annotation confidence Not enough data

Comments

This precursor sequence was predicted by comparative computational approaches. The excised miRNA sequence is predicted and the precise 5' or 3' end unknown. A PCR amplification protocol confirmed that the strand containing the predicted miR is predominantly expressed.

Genome context

chrX: 3755150-3755243 [+]

Mature cel-miR-266

• Accession: MIMAT0000322
• Description: Caenorhabditis elegans cel-miR-266 mature miRNA
• Sequence: 23 - AGGCAAGACUUUGGCAAAGC - 42
• Evidence: experimental ; PCR [1], Illumina [2]

References

1. PubMed ID: 12769849
   Computational and experimental identification of C. elegans microRNAs
   "Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J"
   "Mol Cell (2003) 11:1253-1263


2. PubMed ID: 19460142
   Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development
   Kato M, de Lencastre A, Pincus Z, Slack FJ
   Genome Biol (2009) 10:R54