Stem-loop sequence cel-mir-273

AccessionMI0000353 (change log)
DescriptionCaenorhabditis elegans miR-273 stem-loop
Literature search

3 open access papers mention cel-mir-273
(3 sentences)

Stem-loop
      -uc     g              uu       u    uuuuuuu 
5' acc   guuuu ggagcagccggcau  uacgggc acac       a
   |||   ||||| ||||||||||||||  ||||||| ||||        
3' ugg   uaaaa uuucgucggcugug  augcccg ugug       a
      cuu     g              uc       -    uaguuaa 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was predicted by computational approaches and validated using a PCR amplification protocol.

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 14947039-14947132 [+]
sense
E01F3.1c ; E01F3.1c; intron 2
E01F3.1h ; E01F3.1h; intron 2
E01F3.1f ; E01F3.1f; intron 3
E01F3.1g ; E01F3.1g; intron 3
E01F3.1b ; E01F3.1b; intron 4
E01F3.1j ; E01F3.1j; intron 4
E01F3.1e ; E01F3.1e; intron 5
E01F3.1i ; E01F3.1i; intron 5
Database links

Mature sequence cel-miR-273

Accession MIMAT0000329
Sequence

59 - 

ugcccguacugugucggcug

 - 78

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; PCR [1]
Predicted targets

References

1
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).