![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence dme-mir-274 |
|||||
Accession | MI0000355 (change log) | ||||
Description | Drosophila melanogaster miR-274 stem-loop | ||||
Gene family | MIPF0000264; mir-274 | ||||
Literature search |
5 open access papers mention dme-mir-274 | ||||
Stem-loop |
uccug -- c a cu gu 5' uguugcaguuucgu uuuguga cg ca aacggguaauu uuggc |||||||||||||| ||||||| || || ||||||||||| |||| c 3' acgacguuaaagua aaacacu gc gu uugcucauuag gaccg ----a uu a - uu -- |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
This sequence is computationally predicted based on conservation in D. pseudoobscura. The precise 5' or 3' ends are unknown. Northern blotting confirmed that the strand containing the predicted miR is predominantly expressed. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence dme-miR-274-5p |
|
Accession | MIMAT0000332 |
Previous IDs | dme-miR-274 |
Sequence |
20 - uuugugaccgacacuaacgggua - 42 |
Deep sequencing | 295479 reads, 43 experiments |
Evidence | experimental; Northern [1], 454 [2-3], Illumina [3] |
Database links |
|
Predicted targets |
|
Mature sequence dme-miR-274-3p |
|
Accession | MIMAT0020800 |
Sequence |
64 - cucguuuuugcgaucacaaauua - 86 |
Deep sequencing | 133 reads, 21 experiments |
Evidence | not experimental |
Database links |
|
References |
|
1 |
PMID:12844358
"Computational identification of Drosophila microRNA genes"
Genome Biol. 4:R42(2003).
|
2 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
3 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|