Stem-loop sequence dme-mir-274

AccessionMI0000355 (change log)
DescriptionDrosophila melanogaster miR-274 stem-loop
Gene family MIPF0000264; mir-274
Literature search

5 open access papers mention dme-mir-274
(8 sentences)

Stem-loop 
   uccug              --       c  a  cu           gu      
5'      uguugcaguuucgu  uuuguga cg ca  aacggguaauu  uuggc 
        ||||||||||||||  ||||||| || ||  |||||||||||  |||| c
3'      acgacguuaaagua  aaacacu gc gu  uugcucauuag  gaccg 
   ----a              uu       a  -  uu           --
Get sequence
Deep sequencing
295631 reads, 2.16e+03 reads per million, 43 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is computationally predicted based on conservation in D. pseudoobscura. The precise 5' or 3' ends are unknown. Northern blotting confirmed that the strand containing the predicted miR is predominantly expressed.

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3L: 11656918-11657017 [+]
antisense
FBtr0076133 ; CG32085-RA; intron 4
Database links

Mature sequence dme-miR-274-5p

Accession MIMAT0000332
Previous IDsdme-miR-274
Sequence

20 -  

uuugugaccgacacuaacgggua

 - 42

Get sequence
Deep sequencing295479 reads, 43 experiments
Evidence experimental; Northern [1], 454 [2-3], Illumina [3]
Database links
Predicted targets

Mature sequence dme-miR-274-3p

Accession MIMAT0020800
Sequence

64 -  

cucguuuuugcgaucacaaauua

 - 86

Get sequence
Deep sequencing133 reads, 21 experiments
Evidence not experimental
Database links

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
3
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).