![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence dme-mir-275 |
||||||
Accession | MI0000356 (change log) | |||||
Description | Drosophila melanogaster miR-275 stem-loop | |||||
Gene family | MIPF0000187; mir-275 | |||||
Literature search |
![]()
11 open access papers mention dme-mir-275 | |||||
Stem-loop |
uguaaa c u -a ug gg guuuu 5' gucu cuacc ugcgcgcua ucag acc ggcug u |||| ||||| ||||||||| |||| ||| ||||| 3' caga ggugg gcgcgcgau aguc ugg cugac u uauaua c u ga ca -a auaua |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
miR-275 was reported independently in references [1] and [2]. Computational prediction followed by northern blotting confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [2] confirmed the 5' end of the excised miRNA by cloning and reported a length distribution of 19-25 nt with 22 nt the most commonly expressed. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence dme-miR-275-5p |
|
Accession | MIMAT0020801 |
Sequence |
20 - cgcgcuaaucagugaccggggcu - 42 |
Deep sequencing | 14821 reads, 49 experiments |
Evidence | not experimental |
Database links |
|
Mature sequence dme-miR-275-3p |
|
Accession | MIMAT0000333 |
Previous IDs | dme-miR-275 |
Sequence |
59 - ucagguaccugaaguagcgcgcg - 81 |
Deep sequencing | 193261 reads, 49 experiments |
Evidence | experimental; Northern [1], cloned [2], 454 [3-4], Illumina [4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12844358
"Computational identification of Drosophila microRNA genes"
Genome Biol. 4:R42(2003).
|
2 |
PMID:12919683
"The small RNA profile during Drosophila melanogaster development"
Dev Cell. 5:337-350(2003).
|
3 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
4 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|