Stem-loop sequence dme-mir-275

Accession

MI0000356 (change log)

Description

Drosophila melanogaster miR-275 stem-loop

Gene family

MIPF0000187; mir-275

Literature search

11 open access papers mention dme-mir-275
(19 sentences)

Stem-loop

   uguaaa    c     u         -a    ug   gg     guuuu 
5'       gucu cuacc ugcgcgcua  ucag  acc  ggcug     u
         |||| ||||| |||||||||  ||||  |||  |||||      
3'       caga ggugg gcgcgcgau  aguc  ugg  cugac     u
   uauaua    c     u         ga    ca   -a     auaua 

Deep sequencing

208089 reads, 2.64e+03 reads per million, 49 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-275 was reported independently in references [1] and [2]. Computational prediction followed by northern blotting confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [2] confirmed the 5' end of the excised miRNA by cloning and reported a length distribution of 19-25 nt with 22 nt the most commonly expressed.

Genome context

• Coordinates (Release_6; GCA_000001215.4): chr2L: 7425795-7425892 [+]
• Overlapping transcripts:

  sense

  FBtr0332524 ; CR43857-RA; exon 2

  FBtr0332525 ; CR43857-RB; exon 2

Clustered miRNAs

< 10kb from dme-mir-275

• dme-mir-275: chr2L: 7425795-7425892 [+]
• dme-mir-305: chr2L: 7425972-7426044 [+]

Database links

• RNAcentral:URS000059185F_7227
• miRBase Tracker:MI0000356

Mature sequence dme-miR-275-5p

• Accession: MIMAT0020801
• Sequence: 20 - cgcgcuaaucagugaccggggcu - 42
• Deep sequencing: 14821 reads, 49 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS0000591BFC_7227

Mature sequence dme-miR-275-3p

• Accession: MIMAT0000333
• Previous IDs: dme-miR-275
• Sequence: 59 - ucagguaccugaaguagcgcgcg - 81
• Deep sequencing: 193261 reads, 49 experiments
• Evidence: experimental; Northern [1], cloned [2], 454 [3-4], Illumina [4]
• Database links:
  • RNAcentral:URS000045B410_7227
• Predicted targets:
  • TargetScanFly:dme-miR-275
  • microrna.org:dme-miR-275-3p

References

1. PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2. PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3. PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4. PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).