Stem-loop sequence dme-mir-275

Accession MI0000356
Description Drosophila melanogaster miR-275 stem-loop
Gene family MIPF0000187; mir-275
Stem-loop 
uguaaa    c     u         -a    ug   gg     guuuu 
      gucu cuacc ugcgcgcua  ucag  acc  ggcug     u
      |||| ||||| |||||||||  ||||  |||  |||||      
      caga ggugg gcgcgcgau  aguc  ugg  cugac     u
uauaua    c     u         ga    ca   -a     auaua
Get sequence
Deep sequencing
210029 reads, 50 experiments
Comments

miR-275 was reported independently in references [1] and [2]. Computational prediction followed by northern blotting confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [2] confirmed the 5' end of the excised miRNA by cloning and reported a length distribution of 19-25 nt with 22 nt the most commonly expressed. The sequence is localised to chromosome 2L.

Genome context
Coordinates (BDGP5.0) Overlapping transcripts
2L: 7425795-7425892 [+]
intergenic
Clustered miRNAs
< 10kb from dme-mir-275
dme-mir-275 2L: 7425795-7425892 [+]
dme-mir-305 2L: 7425972-7426044 [+]

Mature sequence dme-miR-275-5p

Accession MIMAT0020801
Sequence

20 -  

cgcgcuaaucagugaccggggcu

 - 42

Get sequence
Deep sequencing 6969 reads, 50 experiments
Evidence not experimental
Predicted targets

Mature sequence dme-miR-275-3p

Accession MIMAT0000333
Previous IDs dme-miR-275
Sequence

59 -  

ucagguaccugaaguagcgcgcg

 - 81

Get sequence
Deep sequencing 203043 reads, 50 experiments
Evidence experimental; Northern [1], cloned [2], 454 [3-4], Solexa [4]
Predicted targets

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).