Stem-loop sequence dme-mir-133

Accession MI0000362
Description Drosophila melanogaster miR-133 stem-loop
Gene family MIPF0000029; mir-133
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-133_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-133 is a type of non-coding RNA called a microRNA that was first experimentally characterised in mice. Homologues have since been discovered in several other species including invertebrates such as the fruitfly Drosophila melanogaster. Each species often encodes multiple microRNAs with identical or similar mature sequence. For example, in the human genome there are three known miR-133 genes: miR-133a-1, miR-133a-2 and miR-133b found on chromosomes 18, 20 and 6 respectively. The mature sequence is excised from the 3' arm of the hairpin. miR-133 is expressed in muscle tissue and appears to repress the expression of non-muscle genes.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
---accug    -    ug             cauc  gu     -  guu 
        caac acug  uguagcugguuga    gg  cagau cu   u
        |||| ||||  |||||||||||||    ||  ||||| ||    
        guug ugac  augucgaccaacu    cc  guuua ga   u
caacagua    g    cg             -ucc  ug     c  acu 
Get sequence
Deep sequencing
46545 reads, 47 experiments
Comments

miR-133 was reported independently by three groups using computational prediction [2], Northern blot analysis [1] and cloning [3]. References [1] and [2] confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [3] confirmed the ends of the excised miRNA by cloning. The sequence maps to chromosome 2L.

Genome context
Coordinates (BDGP5.0) Overlapping transcripts
2L: 20616617-20616714 [+]
intergenic
Clustered miRNAs
< 10kb from dme-mir-133
dme-mir-133 2L: 20616617-20616714 [+]
dme-mir-288 2L: 20618366-20618462 [-]

Mature sequence dme-miR-133-5p

Accession MIMAT0020806
Sequence

19 - 

agcugguugacaucgggucagau

 - 41

Get sequence
Deep sequencing 740 reads, 32 experiments
Evidence not experimental
Predicted targets

Mature sequence dme-miR-133-3p

Accession MIMAT0000340
Previous IDs dme-miR-133
Sequence

57 - 

uugguccccuucaaccagcugu

 - 78

Get sequence
Deep sequencing 45805 reads, 47 experiments
Evidence experimental; Northern [1,3], 454 [4-5], Solexa [5]
Predicted targets

References

1
2
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
3
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).