Stem-loop sequence dme-mir-280

AccessionMI0000365 (change log)
DescriptionDrosophila melanogaster miR-280 stem-loop
Gene family MIPF0000240; mir-280
Literature search

3 open access papers mention dme-mir-280
(5 sentences)

Stem-loop
   ---------u      --ua     u   g                --a      
5'           ggcuuu    uguau uac uugcauaugaaaugau   uuuau 
             ||||||    ||||| ||| ||||||||||||||||   |||| a
3'           cuggag    acgua aug gacguauauuuuauua   aaaug 
   gucacaccuc      cuga     u   -                gac      
Get sequence
Deep sequencing
9 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is computationally predicted based on conservation in D. pseudoobscura. The precise 5' or 3' ends are unknown. Northern blotting confirmed that the strand containing the predicted miR is predominantly expressed.

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 8298106-8298200 [+]
intergenic
Database links

Mature sequence dme-miR-280-5p

Accession MIMAT0000343
Previous IDsdme-miR-280
Sequence

10 - 

uguauuuacguugcauaugaaaugaua

 - 36

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Northern [1]
Predicted targets

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).