|
miRBase |
|
Stem-loop sequence dme-mir-282 |
|||||
| Accession | MI0000367 | ||||
| Description | Drosophila melanogaster miR-282 stem-loop | ||||
| Gene family | MIPF0000150; mir-282 | ||||
| Stem-loop |
a - -cuaa ac u ugcau a guuu ccuu aucuagccucu uaggcu ugucug ucg a |||| |||| ||||||||||| |||||| |||||| ||| a caag ggaa uggauuggaga auccga acagac agc g a c ccaug au u ----u c |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
Mature sequence dme-miR-282-5p |
|
| Accession | MIMAT0000346 |
| Previous IDs | dme-miR-282 |
| Sequence |
17 - uagccucuacuaggcuuugucugu - 40 |
| Deep sequencing | 508297 reads, 50 experiments |
| Evidence | experimental; Northern [1], 454 [2-3], Solexa [3] |
| Predicted targets |
|
Mature sequence dme-miR-282-3p |
|
| Accession | MIMAT0020809 |
| Sequence |
60 - acauagccuauaagagguuagg - 81 |
| Deep sequencing | 160431 reads, 50 experiments |
| Evidence | not experimental |
| Predicted targets |
|
References |
|
| 1 |
PMID:12844358
"Computational identification of Drosophila microRNA genes"
Genome Biol. 4:R42(2003).
|
| 2 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
| 3 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|