miRBase entry: dme-mir-281-2

Stem-loop dme-mir-281-2


Accession
MI0000370
Description
Drosophila melanogaster dme-mir-281-2 precursor miRNA
Gene family
MIPF0000087; mir-46

Literature search
13 open access papers mention dme-mir-281-2
(28 sentences)

Sequence

2101769 reads, 12674 reads per million, 49 experiments
cgaauugugaaaugAAGAGAGCUAUCCGUCGACAGUcaaguuaagaccgauuguaauacUGUCAUGGAAUUGCUCUCUUUGUauaacauucg
(((((.((...(((((((((((..(((((.((((((..((((......)))).....)))))))))))...)))))))))))...)))))))

Structure
     u  gaa           -UA     C      ---ca    aa 
cgaau gu   augAAGAGAGC   UCCGU GACAGU     aguu  g
||||| ||   |||||||||||   ||||| ||||||     ||||   
gcuua ca   UGUUUCUCUCG   AGGUA CUGUca     uuag  a
     -  aua           UUA     -      uaaug    cc 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-281 was reported independently in references [1] and [2]. The sequence in this entry is from reference [2] which identified a 23 nt excised sequence from the 3' arm of the precursor by cloning. Reference [1] reported the reverse complement of this foldback precursor from computational prediction and northern blotting. The predicted mature sequence (5' and 3' ends unknown) from the 3' arm of the reverse complement was named miR-281b in reference [1] and is designated miR-281-2* here.

Genome context
chr2R: 12170153-12170244 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from dme-mir-281-2
Name Accession Chromosome Start End Strand Confidence




Database links

Mature dme-miR-281-3p

Accession MIMAT0000345
Description Drosophila melanogaster dme-miR-281-3p mature miRNA
Sequence 60 - UGUCAUGGAAUUGCUCUCUUUGU - 82
Evidence experimental
Northern [1], cloned [2], 454 [3-4], Illumina [4]
Database links

Mature dme-miR-281-2-5p

Accession MIMAT0000349
Description Drosophila melanogaster dme-miR-281-2-5p mature miRNA
Sequence 15 - AAGAGAGCUAUCCGUCGACAGU - 36
Evidence experimental
Northern [1], 454 [3-4], Illumina [4]
Database links

References

  1. PubMed ID: 12919683
    The small RNA profile during Drosophila melanogaster development
    "Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T"
    "Dev Cell (2003) 5:337-350

  2. PubMed ID: 17989254
    Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs
    "Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC"
    "Genome Res (2007) 17:1850-1864

  3. PubMed ID: 17989255
    Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes
    "Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M"
    "Genome Res (2007) 17:1865-1879

  4. PubMed ID: 12844358
    Computational identification of Drosophila microRNA genes
    "Lai EC, Tomancak P, Williams RW, Rubin GM"
    "Genome Biol (2003) 4:R42