Stem-loop sequence dme-mir-124

AccessionMI0000373
DescriptionDrosophila melanogaster miR-124 stem-loop
Gene family MIPF0000021; mir-124
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-124_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373), nematode worms (MI0000302), mouse (MI0000150) and human (MI0000443). The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation. However these results are controversial since other reports have described a role for miR-124 during neuronal differentiation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ---ucauuuggua     uu   c      c      ag    a    uau 
5'              cguuu  cuc ugguau cacugu  gccu uaug   u
                |||||  ||| |||||| ||||||  |||| ||||   u
3'              gcaag  gag accgua guggcg  cgga auac   c
   uaaacaucuugac     -c   a      a      ca    -    cac 
Get sequence
Deep sequencing
666991 reads, 4.25e+04 reads per million, 48 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-124 was reported independently in references [1] and [2]. Computational prediction followed by northern blotting confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [2] confirmed the 5' end of the excised miRNA by cloning and reported a length distribution of 19-23 nt with 23 nt the most commonly expressed.

Genome context
Coordinates (BDGP5.0) Overlapping transcripts
2L: 17566370-17566469 [+]
intergenic
Clustered miRNAs
< 10kb from dme-mir-124
dme-mir-1242L: 17566370-17566469 [+]
dme-mir-2872L: 17574610-17574702 [+]
Database links

Mature sequence dme-miR-124-5p

Accession MIMAT0020813
Sequence

23 - 

gguauccacuguaggccuauaug

 - 45

Get sequence
Deep sequencing6564 reads, 35 experiments
Evidence not experimental
Predicted targets

Mature sequence dme-miR-124-3p

Accession MIMAT0000351
Previous IDsdme-miR-124
Sequence

57 - 

uaaggcacgcggugaaugccaag

 - 79

Get sequence
Deep sequencing549591 reads, 48 experiments
Evidence experimental; cloned [2], Northern [2-3], 454 [4-5], Illumina [5]
Validated targets
Predicted targets

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).