![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence dme-mir-79 |
||||||||||
Accession | MI0000374 (change log) | |||||||||
Description | Drosophila melanogaster miR-79 stem-loop | |||||||||
Gene family | MIPF0000014; mir-9 | |||||||||
Literature search |
![]()
12 open access papers mention dme-mir-79 | |||||||||
Stem-loop |
u ag -acuu u cgc g -- au 5' ga cug gcca ugcuuugg uuuagcu uauga uag u || ||| |||| |||||||| ||||||| ||||| ||| u 3' cu gac cggu acgaaacc agaucga auacu auc a a -g gucuu u auu a uc aa |
|||||||||
Deep sequencing |
| |||||||||
Confidence |
Annotation confidence: high
| |||||||||
Comments |
miR-79 was reported independently by three groups using computational prediction [2], Northern blot analysis [1] and cloning [3]. References [1] and [2] confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [3] confirmed the ends of the excised miRNA by cloning. |
|||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
|
Mature sequence dme-miR-79-5p |
|
Accession | MIMAT0020814 |
Sequence |
19 - gcuuuggcgcuuuagcuguauga - 41 |
Deep sequencing | 1343 reads, 47 experiments |
Evidence | not experimental |
Database links |
|
Mature sequence dme-miR-79-3p |
|
Accession | MIMAT0000352 |
Previous IDs | dme-miR-79 |
Sequence |
60 - uaaagcuagauuaccaaagcau - 81 |
Deep sequencing | 279078 reads, 49 experiments |
Evidence | experimental; Northern [1], cloned [3], 454 [4-5], Illumina [5] |
Database links |
|
Predicted targets |
|
References |
|
1 | |
2 |
PMID:12844358
"Computational identification of Drosophila microRNA genes"
Genome Biol. 4:R42(2003).
|
3 |
PMID:12919683
"The small RNA profile during Drosophila melanogaster development"
Dev Cell. 5:337-350(2003).
|
4 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
5 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|