Stem-loop sequence dme-mir-79

Accession

MI0000374 (change log)

Description

Drosophila melanogaster miR-79 stem-loop

Gene family

MIPF0000014; mir-9

Literature search

12 open access papers mention dme-mir-79
(22 sentences)

Stem-loop

   u  ag   -acuu    u        cgc       g     --   au 
5'  ga  cug     gcca ugcuuugg   uuuagcu uauga  uag  u
    ||  |||     |||| ||||||||   ||||||| |||||  |||  u
3'  cu  gac     cggu acgaaacc   agaucga auacu  auc  a
   a  -g   gucuu    u        auu       a     uc   aa 

Deep sequencing

280461 reads, 6.74e+03 reads per million, 49 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-79 was reported independently by three groups using computational prediction [2], Northern blot analysis [1] and cloning [3]. References [1] and [2] confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [3] confirmed the ends of the excised miRNA by cloning.

Genome context

• Coordinates (Release_6; GCA_000001215.4): chr2L: 16698554-16698650 [+]
• Overlapping transcripts:

  sense

  FBtr0100459 ; grp-RD; intron 4

  FBtr0080884 ; grp-RB; intron 6

  FBtr0080886 ; grp-RA; intron 6

  FBtr0080885 ; grp-RC; intron 7

Clustered miRNAs

< 10kb from dme-mir-79

• dme-mir-9c: chr2L: 16697924-16698015 [+]
• dme-mir-306: chr2L: 16698404-16698488 [+]
• dme-mir-79: chr2L: 16698554-16698650 [+]
• dme-mir-9b: chr2L: 16698744-16698834 [+]

Database links

• RNAcentral:URS00005D63BD_7227
• miRBase Tracker:MI0000374

Mature sequence dme-miR-79-5p

• Accession: MIMAT0020814
• Sequence: 19 - gcuuuggcgcuuuagcuguauga - 41
• Deep sequencing: 1343 reads, 47 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS000025E6EF_7227

Mature sequence dme-miR-79-3p

• Accession: MIMAT0000352
• Previous IDs: dme-miR-79
• Sequence: 60 - uaaagcuagauuaccaaagcau - 81
• Deep sequencing: 279078 reads, 49 experiments
• Evidence: experimental; Northern [1], cloned [3], 454 [4-5], Illumina [5]
• Database links:
  • RNAcentral:URS0000167E65_7227
• Predicted targets:
  • TargetScanFly:dme-miR-79
  • microrna.org:dme-miR-79-3p

References

1. PMID:12812784 "Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity" Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V Dev Biol. 259:9-18(2003).
2. PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
3. PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4. PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5. PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).