Stem-loop sequence dme-mir-285

Accession MI0000377
Description Drosophila melanogaster miR-285 stem-loop
Gene family MIPF0000009; mir-29
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-29_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-29 microRNA precursor, or pre-miRNA, is a small RNA molecule in the shape of a stem-loop or hairpin. Each arm of the hairpin can be processed into one member of a closely related family of short non-coding RNAs that are involved in regulating gene expression. The processed, or "mature" products of the precursor molecule are known as microRNA (miRNA), and have been predicted or confirmed in a wide range of species (see 'MIPF0000009' in miRBase: the microRNA database).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
---  ga       -a     ga    u      a    --uaucag   aa 
   uc  aucgaag  acuga  ucga uggugc uaga        gag  c
   ||  |||||||  |||||  |||| |||||| ||||        |||   
   ag  uaguuuu  ugacu  agcu accacg aucu        cuc  c
caa  aa       cg     aa    u      -    caauuuaa   ac 
Get sequence
Deep sequencing
162138 reads, 40 experiments
Comments

miR-285 was reported independently in references [1] and [2]. Computational prediction followed by northern blotting confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [2] confirmed the ends of the excised miRNA by cloning. The sequence is localised to chromosome 3L.

Genome context
Coordinates (BDGP5.0) Overlapping transcripts
3L: 11939193-11939291 [-]
intergenic

Mature sequence dme-miR-285-5p

Accession MIMAT0020817
Sequence

13 - 

acugagaucgauuggugcauaga

 - 35

Get sequence
Deep sequencing 2800 reads, 22 experiments
Evidence not experimental
Predicted targets

Mature sequence dme-miR-285-3p

Accession MIMAT0000356
Previous IDs dme-miR-285
Sequence

64 - 

uagcaccauucgaaaucagugc

 - 85

Get sequence
Deep sequencing 159321 reads, 39 experiments
Evidence experimental; cloned [2], 454 [3], Solexa [4]
Predicted targets

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).