Stem-loop sequence dme-mir-287

AccessionMI0000381 (change log)
DescriptionDrosophila melanogaster miR-287 stem-loop
Gene family MIPF0000224; mir-287
Literature search

1 open access papers mention dme-mir-287
(2 sentences)

Stem-loop
   ggacgccggggauguaugggugug  g    -  -    --   -gc           a 
5'                         ua gguc ug aaau  uuu   acacauuuaca u
                           || |||| || ||||  |||   ||||||||||| a
3'                         gu ucag ac uuug  aaa   uguguaaaugu a
   -----------------------a  g    c  g    cu   agu           u 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is computationally predicted based on conservation in D. pseudoobscura. The precise 5' or 3' ends are unknown. Northern blotting confirmed that the strand containing the predicted miR is predominantly expressed.

Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 17574610-17574702 [+]
intergenic
Clustered miRNAs
< 10kb from dme-mir-287
dme-mir-124chr2L: 17566370-17566469 [+]
dme-mir-287chr2L: 17574610-17574702 [+]
Database links

Mature sequence dme-miR-287-3p

Accession MIMAT0000360
Previous IDsdme-miR-287
Sequence

65 - 

uguguugaaaaucguuugcac

 - 85

Get sequence
Deep sequencing7 reads, 3 experiments
Evidence experimental; Northern [1]
Predicted targets

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).