Stem-loop sequence dme-bantam

Accession MI0000387
Previous IDs dme-bantam;bantam
Description Drosophila melanogaster bantam stem-loop
Gene family MIPF0000153; bantam
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled bantam_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology bantam microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
au     uac    c          uu      g   -  uu 
  uugac   gaaa cgguuuucga  ugguuu acu gu  u
  |||||   |||| ||||||||||  |||||| ||| ||  u
  aacug   uuuu gucgaaaguu  acuaga uga ca  c
--     ---    a          uu      g   a  ua 
Get sequence
Deep sequencing
4441828 reads, 50 experiments
Comments

bantam microRNA was predicted independently by two groups using computational approaches [1,2]. Northern blotting confirmed that the strand containing the predicted miR is predominantly expressed. Subsequent cloning studies have independently identified the same miRNA and confirmed the 5' end [3]. A length distribution of 20-23 nt was reported with a 23 nt sequence the most commonly expressed. bantam is reported to promote tissue growth [1]. bantam expression is temporally and spatially regulated in response to patterning cues. bantam microRNA simultaneously stimulates cell proliferation and prevents apoptosis and is predicted to target the pro-apoptotic gene hid [1]. The sequence maps to chromosome 3L.

Genome context
Coordinates (BDGP5.0) Overlapping transcripts
3L: 642208-642288 [+]
sense
FBtr0306918 ; CR43334-RA; exon 1
FBtr0306918 ; CR43334-RA; exon 1
Database links

Mature sequence dme-bantam-5p

Accession MIMAT0020823
Sequence

15 - 

ccgguuuucgauuugguuugacu

 - 37

Get sequence
Deep sequencing 50900 reads, 50 experiments
Evidence not experimental
Predicted targets

Mature sequence dme-bantam-3p

Accession MIMAT0000365
Previous IDs dme-bantam
Sequence

52 - 

ugagaucauuuugaaagcugauu

 - 74

Get sequence
Deep sequencing 4390927 reads, 50 experiments
Evidence experimental; Northern [1], cloned [3], 454 [5-6], Solexa [6]
Predicted targets

References

1
2
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
3
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4
PMID:12946623 "Big things from a little RNA" Moberg KH, Hariharan IK Trends Cell Biol. 13:455-457(2003).
5
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
6
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).