![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-293 |
||||||||||||||||||||
Accession | MI0000391 (change log) | |||||||||||||||||||
Symbol | MGI:Mir293 | |||||||||||||||||||
Description | Mus musculus miR-293 stem-loop | |||||||||||||||||||
Gene family | MIPF0000068; mir-290 | |||||||||||||||||||
Literature search |
![]()
10 open access papers mention mmu-mir-293 | |||||||||||||||||||
Stem-loop |
u u gg - g a guuc 5' ucaauc gu uacu caaacu ugug cauuuu u |||||| || |||| |||||| |||| |||||| u 3' aguuag cg guga guuuga acgc gugaag u g c uu u g c aaug |
|||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||
Genome context |
|
|||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-293-5p |
|
Accession | MIMAT0004573 |
Previous IDs | mmu-miR-293* |
Sequence |
14 - acucaaacugugugacauuuug - 35 |
Deep sequencing | 14042 reads, 31 experiments |
Evidence | experimental; cloned [2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-293-3p |
|
Accession | MIMAT0000371 |
Previous IDs | mmu-miR-293 |
Sequence |
48 - agugccgcagaguuuguagugu - 69 |
Deep sequencing | 139405 reads, 62 experiments |
Evidence | experimental; cloned [1-2], Northern [1], Illumina [3-4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12919684
"Embryonic stem cell-specific MicroRNAs"
Dev Cell. 5:351-358(2003).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|